(PDF) EL CODIGO DE DIOS - GREGG BRADEN | Jorge A Espín - Academia.edu

EL CODIGO DE DIOS - GREGG BRADEN

2005
Jorge A Espín
This Paper
A short summary of this paper
31 Full PDFs related to this paper
, ~I CODIGO de DIGS El secreto de nuestro pasado, la promesa de nuestro futuro GREGG BRADEN Grupo Editorial Torno, S.A. de C.Y. Nicolas San Juan 1043 03100 Mexico. D.F. la. edici6n, agosto 2005. D edico este libra a la primera generaci6n en la historia escrita que tiene el poder de destruir o preservar todo 10 que amamos. © The God Code Que nuestro legado sea un legado de paz Copyright © 2004 by Gregg Braden para quienes nos lIamaran sus antepasados. Publicado originalmente en ingles por H&y House, Inc. P.O. Box 5100, Carlbad, CA 92018-5100 www.hayhouse.com © 2005, Grupo Editorial Tomo, SA de C.v. Nicolas San Juan 1043, Col. Del Valle 03100 Mexico, D.F. Tels. 5575-6615,5575-8701 Y5575-0186 Fax. 5575-6695 http://www.grupotomo.com.Inx ISBN: 970-775-136-3 Miembro de la Camara Nacional de la Industria Editorial No 2961 Traducci6n: Graciela Frisbie Diseiio de Portada: Emigdio Guevara Formaci6n Tipografica: Servicios Editoriales Aguirre, S.c. Supervisor de producci6n: Leonardo Figueroa Ninguna parte de esta publicaci6n podni ser reproducida o transmitida en cualquier forma, 0 por cualquier medio electr6nico 0 mecanico, incluyendo fotocopiado, cassette, etc., sin autorizaci6n por escrito del editor titular del Copyright. Este Iibro se public6 conforme al contrato establecido entre Hay House, Inc.; InterLicense, Ltd. y Grupo Editorial Torno, S.A. de C. V Imprcso ell Mcxil.:o - Printed in Mexico CONTENIDO Nota del autor . . . . . . . . . . . . . . . . . . . . . . . . . . . . XI Introduccion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . XIII PRIMERA PARTE: (Quienes somos? Indieios del misterio en S1 . . . . . . . . . . . . . . . . 1 Capitulo 1: Historia: El relato de nuestras diferencias . . . . . . . . . . . . . . . . . . 5 Capitulo 2: Huesos, libros y celulas: Cuando las evideneias y las teorfas chocan. . . . . . . . . . . . 27 Capitulo 3: De los libros perdidos de la creaeion: Los poderes del eielo en cuerpos de la Tierra. . . . . . . . . 53 SEGUNDA PARTE: El descubrimiento: Toda vida parte del nombre de Dios . . . . . . . . . . . 77 Capitulo 4: El creador del universo: En palabras de otras epocas . . . . . . . . . . . . . . . 81 Capitulo 5: El descubrimiento: Cuando las letras se convierten en elementos. . . . . . 107 Capitulo 6: El codigo dentro del codigo: En cada celula de toda vida, esta el nombre de Dios. . . . . . . . . 139 VIII El C6digo de Dios TERCERA PARTE: El significado: Como aplicar el mensaje a nuestra vida . . . . . . . 175 Capitulo 7: Mensaje del primer dia: Como leer ellenguaje de Dios . . . 179 Capitulo 8: ~Que hemos aprendido? Como sobrevivir en nuestro futuro con las lecciones de nuestro pasado . . . . . . . . . . . . . . . . . . . . . 211 Capitulo 9: El codigo de Dios: Una razon para creer . . . . . . . . . . . . . . . . . . . 253 Aplndice A: El orden secreto del alfabeto arabe ;........... 297 Aplndice B: La tabla periodica de los elementos. . . . . . . . . . . . . . . . . . . 299 Aplndice Co El numero de atomos de Hidrogeno, Nitrogeno, Oxigeno y Carbono en cada una de las cuatro bases delADN, . 301 Aplndice D: Ilustracion detallada de los atomos de Hidrogeno, Nitrogeno, Oxigeno y Carbono en cada una de las bases del ADN, que muestra sus equivalentes como letras hebreas . 303 Notas finales 305 Reconocimientos . 329 Sobre el autor . 335 NOTA DEL AUTOR E n 10 que concierne al genera de Dios: Aunque el principio de Dios definitivamente implica tanto el genera masculi- no como el femenino, y por 10 tanto carece de genero, las refe- rencias hist6ricas sugieren que el principio masculino activo de Dios en el Cielo se mezcla con el principio femenino recep- tor de la "Madre Tierra" para praducir la dualidad de la vida que se une en el interior de nuestras cuerpos. Por esta raz6n, se entiende que a 10 largo de este libro, las referencias a "£1" son referencias al principio masculino de Dios, unicamente en el acto de la creaci6n. Fechas convencionales: Sigue existiendo un debate entre arque610gos e historiadores relacionado con la manera de in- dicar fechas hist6ricas como antes de fa era comun (A.E.C), para las fechas anteriores al ano "I"; y era comun (E.C.) para fechas desde el ano "1" hasta el presente; y las notas que soHan usarse: antes de Cristo (a.C.) y despues de Cristo (d.C.) En este libra se utilizan las notas ya convencionales en la acrualidad de A.E.C y E.C., con el prop6sito de tener coherencia y claridad. El termino hombre: En muchos textos antiguos, traduccio- nes modernas y tradiciones que se mencionan en este libra, se usa la palabra hombrt para referirse a la humanidad. Es obvio que en eI contexte de la antigiiedad la intenci6n era incluir al XII El C6digo de Dios hombre y a la mujer, al igual que a los ninos, y r~presenta a toda existencia humana. En un esfuerzo por ser coherente con ellenguaje de los textos, en El GJdigo de Dios se ha utilizado tambien este termino convencional. INTRODUCCION A veces las soluciones a los misterios mas profundos de la vida se encuentran en los lugares mas extranos. En una vision retrospectiva, una vez que los descubrimientos se hacen y los misterios se resuelven, es comun encontrar que, de he- cho, las respuestas mas escurridizas siempre habian estado pre- sentes y que simplemente no se les habia reconocido. En estos casos, 10 obvio parece ocultarse, como 10 sugiere el proverbio de que "los arboles no dejan ver el bosque". La busqueda de evidencias de "la gran explosion", la explosion cosmica que se cree puso en movimiento este universo, es un ejemplo de este tipo de descubrimientos. En 1960, los Laboratorios de la Bell Telephone en Hol- mdel, Nueva Jersey, construyeron una antena en forma de pla- to como parte de un proyecto de comunicaciones via satelite llamado Echo. Para 1962, sin embargo, nuevos descubrimien- tos hicieron que la antena fuera obsoleta, asi que quedo dispo- nible como telescopio de radio para investigaciones. Dos empleados dellaboratorio, Arno Penzias y Robert Wilson, es- taban interesados en usar la antena para medir senales debiles de radio entre galaxias distantes. Cuando los investigadores empezaron a usar la antena, en- comraron que produda un ruido similar ala estatica el cualles XIV El C6digo de Dios Introducci6n XV dificultaba detectar las sutiles senales que estaban. buscando. La ironia del descubrimiento en los Laboratorios Bell es Aunque los investigadores anteriores habian notado este mo- que la evidencia que contiene la clave de uno de los mayores lesto ruido, supusieron que era un producto secundario de la misterios de la creaci6n fue tan abundante, y apareci6 en una propia antena, y 10 ignoraron. Despues de que cuidadosas ins- forma tan inesperada, que se pas6 por alto y no se tom6 en pecciones eliminaron al equipo como fuente del ruido, Penzias cuenta durante al menos dos anos. Quizas la busqueda de las y Wilson investigaron en forma met6dica otras posibilidades, claves de nuestro origen, de evidencias que poddan servir como desde una prueba nuclear sobre la superficie terrestre llevada un principio sin precedente relacionado con la unidad huma- a cabo en 1962, jhasta las familias de palomas que vivian en na, pudieran revelar una ironia similar. ~Es posible que la res- la antena! Nada pudo revelar la fuente del ruido. puesta a los misterios mas profundos de nuestra existencia sea En la cercana Universidad de Princeton, otro ciendfico, tan abundante en nuestro propio mundo que tambien se haya Robert Dicke, estaba explorando teodas que sugedan que el pasado por alto? universo empez6 en un pasado distante como una primera ex- plosi6n de proporciones inimaginables. Si en realidad habia UN DESCUBRIMIENTO EXTRAORDINARIO QUE VINCULA los alfabetos ocurrido una liberaci6n de energia de tales proporciones, su hebreos y arcibigos de la Biblia con la quimica moderna revela teoda era que debeda haber ecos de ese suceso en forma de ese c6digo perdido: un alfabeto que sepuede traducir, y una clave radiaci6n de microondas; un constante ruido de fondo que del misterio de nuestros odgenes, siempre ha estado presente continuaria impregnando el universo hoy en dia. S6lo despues entre nosotros. AI aplicar este descubrimiento allenguaje de de que los tres cientificos compartieron sus descubrimientos nuestra vida, los elementos familiares de hidr6geno, nitr6ge- entendieron la fuente de la estatica y 10 que habian descubierto. no, oxigeno y carbono que forman nuestro ADN pueden aho- Aunque Penzias.y Wilson habian intentado aprender mas ra reemplazarse con las letras clave de los lenguajes antiguos. sobre nuestro universo estudiando senales entre las galaxias, la AI hacerlo, el c6digo de toda vida se transforma en las palabras "estatica" que detectaron en todas partes jera en realidad un de un mensaje eterno. Al traducirse, el mensaje revela que las eco que aun persisda de una antigua explosi6n! Sin darse cuenta, letras precisas del nombre antiguo de Dios existen como un c6digo habfan encontrado la prueba de la teoda de la Gran Explosi6n en la informaci6n genttica de cada dlula, de cada vida. relacionada con la creaci6n, una prueba que sobrevivia desde El mensaje dice: "Dios/Eterno dentro del cuerpo". "el principio". Para 1970, la teorfa era tan ampliamente acepta- El significado: jLa humanidad es una familia unida a tra- da que se Ie llam6 el modelo estdndar de la creaci6n. John Bah- ves de un legado comun, y el resultado de un acto intencional de call, un notable astroffsico de la Universidad de Princeton, hab16 creaci6n! sobre el significado de este descubrimiento diciendo: "El des- Preservado dentro de cada celula de los seis mil millones de cubrimiento de la radiaci6n subordinada de microondas cam- habitantes de nuestro mundo, el mensaje se repite, una y otra bi6 por siempre la naturaleza de la cosmologfa... "1 Penzias y vez, formando los bloques con que se construye nuestra exis- Wilson recibieron eI Premio Nobel por su trabajo en 1978. tencia. Este antiguo mensaje que data del dfa de nuestros or{. XVI El C6digo de Dios Introducci6n XVII genes, permanece dentro de nuestro cuerpo hoy, sin.importar gui6 adelante describiendo este cambio: "La era del descubri- cual sea nuestra raza, religi6n, legado, estilo de vida 0 creen- miento en la ciencia esta Hegando a su fin, y se esta abriendo cias.Como veremos en el capitulo 9, jel c6digo es tan univer- una nueva era de dominio... hoy en dia estamos en la cuspide sal que produce un mensaje identico cuando se traduce ya sea de una transicion que marcara una epoca: de ser observadores allenguaje hebreo 0 al arabigo! pasivos de La naturaleza nos estamos convirtiendo en coreografos El descubrimiento del nombre de Dios dentro de la esen- activos de la naturaleza". 2 cia de toda vida demuestra que no s6lo estamos relacionados De hecho, en los ultimos cien anos Ie hemos arrancado ala unos con otros, sino que estamos relacionados con la vida en creaci6n los eternos secretos de la materia, la concepcion, la vida si, en la forma mas intima imaginable. Desde una brizna de y la muerte. Nuestros hallazgos recien descubiertos nos otor- hierva hasta las vastas extensiones de las selvas 'inexploradas; gan una rara capacidad, desconocida en cualquier epoca del desde una mosca de una fruta que nos mira a traves de las pasado. Con las fuerzas de la naturaleza a nuestras ordenes, numerosas facetas de sus complejos ojos, hasta la mirada fija encontramos que somos capaces de redisefiar nuestro c6digo de los primates, nuestros parientes mas cercanos, cualquier genetico, de disefiar patrones de clima a la medida de nuestras l6gica que se base en nuestras diferencias finalmente se disuel- necesidades, y de crear nuevas formas de vida: poderes que ve ante la evidencia de que toda vida esta hecha con el equiva- hist6ricamente se dejaron en manos de Dios 0 de la naturale- lente quimico de un solo nombre. Con una prueba tan tangible za. Al mismo tiempo, ahora nuestro futuro depende de nues- de un vinculo comun, se nos da una razon para ver mas aHa de tra capacidad para usar nuestras recien descubiertas habilidades los temas que pudieron separarnos en el pasado, y nos propor- con sabiduria. ciona un punto desde el cual empezar cuando nuestras dife- Hoy en dia, nuevos descubrimientos en la ciencia y la tec- rencias parezcan insuperables. nologia han puesto a nuestro alcance el poder de preservar 0 En la medida en que cualquier obra es un producto de su destruir todo 10 que amamos. Por primera vez en la historia epoca hist6rica, este libro recibi6 influencia de las extraordi- conocida, la supervivencia de toda nuestra especie depende de narias circunstancias a que se enfrenta el mundo en estos los las opciones que elija una sola generaci6n. Quizas es precisa- primeros anos del siglo XXI. Quizas quien ha expresado con mente la presencia de tal poder 10 que ahora nos compele a mas claridad el caracter unico de nuestros tiempos fue el Dr. reconocer que somos parte de todo 10 que vemos, y la expre- Michio Kaku, cofundador de la revolucionaria teoria de "string sion de algo aun mas grande. field" [campos en serie] y profesor de fisica te6rica en el City Al enfrentar los desafios unicos de nuestros tiempos, la da- College de Nueva York. "Durante la mayor parte de la historia ve para la paz de nuestro mundo, y tal vez nuestra superviven- humana", observo d Dr. Kaku, "solo podiamos observar, como cia misma, parece existir dentro de cada uno de nosotros, como especladores, la hermosa danza de la naturaleza". Despues de una replica perfecta en el interior de cada celula de nuestro lcrminado d siglo XX. sin embargo, nuesua relaci6n con la cuerpo. Quizas como un testamento para nuestro exito como naturalaa ha asumido un nuevo significado. El Dr. Kaku si- especie, cada miemhro de nuestra familia global lIeva el mis- XVIII El C6digo de Dios Introducci6n XIX mo mensaje como un recordatorio silencioso de nuestro lega- tros ocultos, tienen un tema que es sorprendentemente similar do, grabado el primer dia de nuestra existencia. AI descifrarlo, a traves de divisiones culturales, geograficas y religiosas. A pe- el mensaje revela los siguientes hechos innegables: sar de 10 diferentes que parecen ser las tradiciones a nive1 su- perficial, un tema que las subyace nos recuerda que, como la • Los elementos basicos del ADN: hidr6geno, nitr6- familia de la humanidad, somos mas grandes que cualquier geno, oxigeno y carbono, se traducen directamente diferencia que alguna vez nos haya dividido. formando letras clave de los alfabetos hebreo y ara- Tal vez no sea accidental que un mensaje de unidad tan bigo. poderoso se revele ahora, en los primeros anos de un nuevo • En estos idiomas, nuestro c6digo genetico escribe el milenio. Las estadisticas muestran que e1 siglo xx: compren- nombre de Dios. El mismo nombre vive dentro de di6los cien anos mas sangrientos de la historia humana, en los todos los seres humanos, sin importar cuales sean que se dio muerte a mas personas como resultado de la violen- sus creencias, acciones, estilo de vida, religi6n 0 le- cia, de limpiezas etnicas, de guerras y de genocidio. Cifra que gado. supera las muertes causadas por todos los desastres naturales combinados durante ese periodo (Ver Capitulo 1, Figura 1.2). • Esta relaci6n se describi6 en textos sagrados como el Esa violencia continua en los primeros anos del siglo XXI, con Sepher Yetzirah hebreo, al menos mil anos antes de casi una tercera parte de las naciones del mundo involucradas que la ciencia moderna verificara estas conexiones. en conflictos armados. 3 Ademas de la lucha por obtener ga- • La posibilidad de que esta relaci6n haya ocurri- nancias y recursos, muchas de las hostilidades se basan en dife- do "por casualidad" es aproximadamente de 1 a rencias religiosas, diferencias raciales y fronteras. 200,000. Hoy en dia, los cientificos, investigadores y Hderes religio- sos indican que la humanidad es la unica y mayor amenaza E/ Codigo de Dios es el resultado de 12 anos de investiga- contra nuestro futuro. Las realidades, creadas por el hombre, ci6n y de una busqueda personal de un principio de la unidad de enfermedades que se resisten a todo tipo de medicamentos humana que fuera tan profundo y tan tangible que no pudiera y el colapso de los ecosistemas de la Tierra que se predice para negarse. A partir de 1986, mi busqueda me ha llevado a tem- mediados del siglo, se presentan ante nosotros como los ma- plos, aldeas y monasterios ocultos en algunos de los sitios mas yores retos de nuestros tiempos. Estando presentes tales peli- primitivos. aislados y remotos que quedan hoy en la Tierra.. En gros a nivel mundial, el mayor conglomerado de armamento y estos lugares. he conocido individuos dedicados que conslde- fucrzas militares desde la Segunda Guerra Mundial representa ran que su deber en la vida, es preservar las memorias de nues- d riesgo de involucrar a la Tierra en un conflicto de una mag- tfa apecic y la historia del mundo, y 10 consideran un honor. nitud sin precedente. Este es el escenario en que vivimos dia Nuestras tradidones mas preciadas, contenidas en antiguos tras dla, en e1 que educamos a nuestros hijos, yen el que bus- mitos, en danzas uadicionalcs. en lenguajcs secretos yen regis- (amos la paz para nuestra vida. xx E1 C6digo de Dios Introducci6n XXI Quizas nuestra situacion es muy similar a la de los miem- y une 10 que conocemos de nuestro pasado con 10 que creemos bros de una familia que estan acostumbrados a pasar tanto sobre nuestro presente en un principio unificador unico. Aun- tiempo juntos que olvidan 10 profundo que es en realidad su que muchas personas sospechan que un poder superior des- vinculo familiar. Solo la perdida inesperada de sus seres queri- empena un papel en nuestro mundo, el saber que el nombre dos les hace recordar 10 valiosa que es en realidad la familia y el de Dios esta presente dentro de nuestro cuerpo ofrece una com- tiempo que pasan juntos. Para los sobrevivientes, la "perdida" prension tan profunda, tan personal y sin embargo tan univer- se convierte en el catalizador que los despierta y los saca de sal, que se convierte en La experiencia mas significativa de nuestra una manera de ver la vida y los lanza de golpe a una nueva vida. Mediante esa experiencia, se nos da una razon para en- perspectiva. contrar la paz, y un terreno comun sin precedente a partir del Asi como una perdida puede transformar a una familia, el cual podremos empezar a resolver nuestras dificultades. sufrimiento sin precedente, el deterioro de nuestro mundo, y los intentos de eliminar culturas enteras, podr-ia convertirse en Sobre este [ibro el catalizador que nos despierte, a gran escala, y nos haga ver la realidad de 10 valiosa que es nuestra familia global y el tiempo En la primavera de 1990, deje una prospera carrera como dise- que pasamos juntos. fiador de sistemas de computo en la industria del espacio ae- reo y la defensa para dedicarme, tiempo completo, a desarrollar A diferencia de La familia de nuestro ejemplo, no obstante, y presentar tales principios de unidad. Aunque la investigacion no es necesario que toda La humanidad sufra continua, los descubrimientos que se describen en estas pagi- tales extremos y tragedias antes de que ocurra ese despertar. nas son en si un corpus completo y significativo de informacion. He dividido ellibro en tres secciones claramente distintas, Sin embargo, crear un mundo donde las familias y las nacio- pero relacionadas entre si: la Primera Parte ofrece una historia nes celebren la diversidad y vivan en paz, requiere de algo que y un contexto que nos dicen por que el mensaje que hay en parece estar ausente en muchas de nuestras sociedades actuales: nuestro cuerpo es importante en nuestra vida; la Segunda Par- una razon para honrar la vida, honrarse unos a otros y creer t e describe el descubrimiento y la traduccion del codigo; la que somos parte de algo aun mayor. Estas cualidades pueden 1ercera Parte explica como el mensaje ofrece una rara opor- hacerse realidad solo a traves de la experiencia directa. iPode - t llnidad para sanar las diferencias que dividen a nuestras fami- mos descubrir que esa evidencia viviente del nombre de Dios lias ya nuestro mundo. en el interior del cuerpo de cada mujer, nino y hombre, del Cada persona lee de manera un poco diferente. Para algu- pasado y del presente, ofrece precisamente esa experiencia! nos, es importante conocer1a esencia dellibro en el que estan .1 pumo de invertir su tiempo y energia, antes de leerlo; 10 EL CODIGO DE DIOS ES DEFINITIVAMENTE una obra de paz. Cruza primordial. Orros prefieren permirir que las ideas del auror se las fronteras tradicionales de la ciencia. la re1igi6n y la historia, dcsenvue1van como un trayecro, confiando que al final los lIe- XXII El C6digo de Dios Introducci6n XXIII varan a algo uti!' Los siguientes principios tienen la intenci6n que tiene resultados sorprendentes! El Capitulo 4 revela la re- de ayudar allector a navegar a 10 largo de este libro dependien- laci6n oculta que crea un puente entre nuestras creencias anti- do de sus preferencias individuales. guas y modernas; el Capitulo 5, "El descubrimiento", aplica Para todos los lectores, la Primera Parte prepara el escena- este poderoso vinculo y continua el trayecto hacia el misterio rio describiendo c6mo nuestro anhelo de saber quienes somos de los alfabetos y los c6digos ocultos de letras. El notable ha- Ie ha dado forma ala historia de nuestro mundo. Tanto en las llazgo que reduce las letras y los elementos a un comun deno- persecuciones como en las inquisiciones; tanto en las guerras minador de numeros nos permite comparar "manzanas con santas como en los genocidios, nos hemos definido a traves de manzanas", y relacionar los relatos mas antiguos del Genesis nuestras diferencias. AI mismo tiempo, la ciencia mas avanza- con la ciencia actual. Al hacerlo, el Capitulo 6 revela c6mo el da de la historia ha extendido nuestros ojos y oidos colectivos nombre antiguo y personal de Dios, el nombre que se registr6 hasta los confines del sistema solar, y ahora mas alIa, en nues- mas de 3,500 anos antes de nuestra epoca, jrepresenta el fun- tra busqueda por encontrar c6mo embona111Ds, juntos, en el damento mismo de nuestro ADN! esquema de la creaci6n. Incluso con los milagrosos avances de A quienes se preguntan c6mo un unico mensaje puede re- la tecnologia del siglo XX, la ironia de nuestro tiempo es que presentar una diferencia en nuestro mundo actual, los invito a todavia no hemos descubierto con precisi6n quienes somos. entrar directamente a la porci6n de este libro que aborda esa El Capitulo 3 detalla c6mo algunos de los registros mas pregunta: la Tercera Parte. Despues de la presentaci6n, hecha primitivos de nuestro pasado han intentado responder las pre- en la Segunda Parte, de la historia, la ciencia y la traducci6n guntas mas antiguas de nuestra existencia. Desde el misterioso del mensaje que hay en nuestras celulas, los Capitulos 7,8 y 9 libro "perdido" de Adcin hasta la Biblioteca Gn6stica Nah Ham- abordan 10 que este mensaje significa en nuestra vida. El Capi- maddi, es claro que quienes escribieron estos manuscritos an- tulo 7 nos ayuda a aceptar las implicaciones del nombre de tiguos deseaban compari:ir sus descubrimientos con las Dias en nuestro cuerpo, y los Capitulos 8 y 9 describen el generaciones futuras. El capitulo termina presentando 10 que papel que ese mensaje podria tener en la creaci6n de un puen- a menudo se ha considerado ellibro mas antiguo y mas miste- te entre las diferencias que amenazan nuestra supervivencia. rioso de las tradiciones hebreas, el Sepher Yetzirah, 0 Libro de El Capitulo 9, por ejemplo, describe un antiguo metodo la Creaci6n. para la saluci6n de conflictos que se basa en una visi6n compar- Para los lectores que estan interesados en comprender con t ida de un futuro comun. En ese tipo de tradiciones, la visi6n precisi6n c6mo la molecula del ADN puede leerse como un \c convierte en un terreno camun; ellugar desde el cual em- lenguaje traducible, y desean conocer datos espedficos sobre pczar a al cual regresar cuando las diferencias entre las perso- este descubrimiento, el Capitulo 4 presenta las claves encon- nas parezcan abrumadoras. La clave es que la vision compartida tradas en el Sepher Yetzirah para revelar el vinculo oculto entre (j una txperiencia unificadora que la vision de los participantes los antiguos elementos de fuego, aire y agua, y sus equivalentes flO putdt ntgar. Esta secci6n sugiere que la experiencia recono- directos en ellenguaje actual de la qu{mica: juna corre1aci6n I c que el hecho de que e1 nombre de Dios este presente en Introducci6n XXV XXIV El C6digo de Dios nuestro cuerpo puede tener un prop6sito similar a 13. soluci6n una preocupaci6n mas profunda y mas fundamental. Cada una de problemas a una escala mayor. Este enfoque pod:ia ser ~s­ plantea exactamente la misma pregunta: pecialmente util para los conflictos que se basan en dlferenclas dCudl es fa "medida"para evaluar el costo religiosas y etnicas. humano de nuestras opciones cientificas y politicas a medida que creamos nuestro fUturo? Un l1bro basado en una ;nvestigad6n ser;a 0 un ardculo tecnlco: El signo tangible, verificable y universal de un mensaje, en lPor que este enfoque? el fundamento mismo de la vida, ofrece evidencia innegable Es cieno que este libro habla sobre muchas creencias profun- de que una inteligencia superior subyace nuestra existencia. El das y muy personales. Hacer justicia a todas y cada una de las hecho de que el mensaje sea el "material" del que estamos he- implicaciones del c6digo presente en n.uestras celulas, rebasa chos nos dice que somos parte de un esquema mucho mayor. su capacidad inmediata. Por esta raz6n, opte por concentrar- Nuestra relaci6n con esa inteligencia es un factor que ahora me en el poder del mensaje para crear un puente entre las dife- debe considerarse en la politica y en la ciencia, en la guerra y rencias que hay en nuestras vidas y traer paz a este mundo. en la paz; en politicas que preparen el camino del mafiana. Desde los problemas complejos que rodean al terrorismo y la Por su misma naturaleza, el tema de este libro trasciende lucha de 4,000 alios de duraci6n relacionada con 105 territo- los limites tradicionales de la ciencia y de la espiritualidad. rios del Oriente Medio, hasta el colapso que se ha predicho de Desde las descripciones mas antiguas de nuestro origen, hasta los ecosistemas del mundo y el incremento en el acapio de ar- los mas avanzados puntos de vista cientificos, ha quedado,en mas de efectos masivos, los problemas que nos dividen como claro q!Je para resolver los desafios de nuestros tiempos debe- individuos, familias, religiones y naciones han alcanzado pro- mos buscar mas aHa del pensamiento que los ha definido. AI porciones abrumadoras; y las opciones son mas dificiles que unir la sabiduria de nuestro pasado con la ciencia de nuestro futuro, creamos instrumentos nuevos y poderosos para resol- nunca antes. Existe un antiguo refran que sugiere que cuando las res- ver los problemas de nuestra epoca. AI mismo tiempo, abri- puestas son vagas y las situaciones son dificiles de resolver, por mos una ventana sin precedente hacia los misterios de nuestra 10 general se debe a que no tenemos toda la informaci6n que propia creaci6n. necesitamos; falta algo. Un corpus de evidencias siempre cre- AI igual que con cualquier descubrimiento de naturaleza ciente sugiere que este es precisamente el caso e~ 10 que se tecnica, el reto ha sido transmitir la informaci6n de tal manera refiere a los problemas mas controvertidos de nuestros tiem- que sea exacta y significativa para el publico en general. Cuan- pos. Cuando toda la informaci6n esta presente, las opciones se do empece este proyecto en 1990, recibi asesoria de algunos ven con claridad y los cursos de acci6n son obvios. AI final, expenos quienes me aconsejaron ofrecer el material desde una Dodrfamos descubrir que las crisis actuales son s!ntomas de perspecriva culta. Hacerlo as!. no obstante. signitlcaria revelar XXVI El C6digo de Dios Introducci6n XXVII los hallazgos en etapas que ala larga retrasarian, durante meses darnente debido a su profundidad, se incluye al final del capi- o incluso mos, la publicaci6n final y el poder del mensaje, tulo un resumen de sus puntos clave. (por ejemplo, el estudio de los c6digos numericos de la Biblia hebrea, se retras6 seis afios mientras fue evaluada por compa- neros y arb'Uros) .4 - I El poder del C6digo de Dios Durante ese mismo periodo, otros me animaron a optar Aunque seguiremos refinando nuestra comprensi6n de la ma- por un enfoque menos academico. Creian que valia la pena teria y de la vida durante muchas generaciones futuras, la cues- dejar a un lado las tablas, grificas, notas a pie de pagina y tion que enfrentamos ahora tiene que ver con el equilibrio referencias con tal de tener la oportunidad de compartir el entre la sabidurfa y el poder. iAdquiriremos la sabidurfa para mensaje con rapidez a una mayor audiencia. AI considerar es- equilibrar nuestro conocimiento de la ciencia con las fuerzas tas recomendaciones tan honestas y sinceras, opte por tomar de la naturaleza antes de sufrir las irreparables consecuen- 10 mejor de ambos enfoques y ofrecer ~n libro-que toma "un cias del mal uso de nuestro poder? iSobreviviremos a nuestro curso medio". proceso de aprendizaje? En su obra pionera Hiperespacio, el Siento que al representar las diversas ramas de estudio que Dr. Michio Kaku comparte una perspectiva de nuestra epoca conforman esta obra, la mejor manera de honrar a mis lectores hist6rica tomada del fallecido ffsico Heinz Pagels. A princi- es ofrecerles el descubrimiento como una narraci6n fluida y pios del siglo XX, Pagels comenta los descubrimientos de la no como un informe estructurado. Dentro de la narraci6n, he luz, la energia y la vida y dice que debemos buscar "un orden incluido referencias a la investigaci6n que hizo posible este moral y politico que de cabida a estas fuerzas 0 de 10 contrario libro. Este enfoque me permite compartir el descubrimiento seremos destruidos. Esto pondra a prueba nuestros recursos con responsabilidad, y al mismo tiempo presentarlo oportu- mas p~ofundos en cuanto ala raz6n y la compasi6n".5 namente. AI mismo tiempo, me he esforzado al maximo para AI parecer no existen modelos claros que nos muestren el reducir 10 mas posible el vocabulario tecnico y las explicacio- camino mientras damos forma a las fuerzas de la naturaleza y nes largas, con el fin de permitir un ritmo y un flujo que sea de Dios. Aunque hemos entrado a territorio inexplorado en 10 atractivo para la mayoria de los lectores. Espero que al hacerlo que concierne a la manera precisa de aplicar nuestros recien haya yo creado un libro significativo iY que al mismo tiempo descubiertos poderes, hay algo de 10 que podemos estar segu- sea divertido de leer! ros: A partir de las muchas lecciones que nos han ensefiado las Aun teniendo en mente estas consideraciones, sin duda guerras, la enfermedad, los desastres ecologicos, el odio y el existen porciones de este libro que se captaran como "verbo- sufrimiento del siglo que acaba de pasar, todo puede reducirse sas" y mas tecnicas que otras. Los Capitulos 4 y 5, por ejem- a un unico tema subyacente. Cada una de estas lecciones nos plo, profundizan los detalles de c6mo la quimica de nuestro recuerda la naturaleza sagrada e interconectada de la vida, de cuerpo se relaciona con ellenguaje de los hebreos de la anti- coda vida, en todas partes. El grado en que permanezcamos giiedad. Para aquellos lectores que prefieran no leerlo deteni- fides a 10 que hemos aprendido, yen la medida en que home- XXVIII EI C6digo de Dios mos el principio de la vida en cada eleccion que hagamos, po- dremos estar seguros de no equivocarnos. Las implicaciones de ver nuestro ADN como el mensaje de un poder superior son vastas, son controversiales, nos dan poder y quizas para algunos son abrumadoras. El fruto de nues- tra disposicion favorable a verlo en esa forma, revela nada me- nos que una clave para la paz duradera y una invitacion a asumir P 'fMERA P, nuestro papel como administradores en el milagro de nuestra propia existencia. Ala luz de las muchas posibilidades que este material puede sugerir, EL Codigo de Dios se ha escrito con un proposito expreso en mente: revelar con claridad y sencillez un principio unico de unidad que trasci~nde todas las separa- ciones que se basan en nuestras diferencias y que estan presen- tes en la familia de la humanidad. Barbara Marx Hubbard, visionaria, futurista y arquitecta social, resumio en un enunciado nuestra situacion, cuando dijo: ''Ahora debemos decidir entre una evolucion consciente 0 una extincion mediante el mal uso de nuestros poderes".6 Este li- bro es la historia de una razon para creer que tenemos una opcion, yel poder de un solo nombre para unificar a nuestra familia global aunque existan diferencias que en ocasiones pa- rezcan insuperables. EL Codigo de Dios no pretende ser La solu- cion cuando nos enfrentamos a los mayores retos de la ciencia, la tecnologia y la paz en la historia de nuestra especie. En una epoca en que se pone tanto enfasis en nuestras diferencias, simplemente pretende ser un punto de partida. - Gregg Braden Taos, Nuevo Mexico Diciembre de 2003 Capftulo Uno HISTORIA: El relata de nuestras dlferenclas S omos una especie misteriosa de extremos y contradiccio- nes. Se ha dicho que somos capaces de tener los suefios mas hermosos y de albergar las pesadillas mas tenebrosas, y que ademas tenemos el poder de hacer realidad cada una de nuestras visiones. Quizas en ningun otro momento de la his- toria hemos compartido nuestro mundo con tantos de nues- tros semejantes sintiendonos, al mismo tiempo, tan separados y tan solos. Ademas, las posibilidades de nuestro futuro nunca han albergado tantas promesas, y a la vez, tanto temor. Es den- tro de este contexto de extremos donde buscamos la unidad de nuestro mundo y un significado mas profundo para nuestras vidas. ~Que significaria descubrir una evidencia innegable: una prueba verificable, de que nuestra especie existe como un acto intencional de creaci6n? ~Que tan diferentes sedan nuestras vidas y nuestro mundo, sabiendo que en eI interior de cada 6 EI C6digo de Dios Historia 7 celula de cada mujer, cada hombre y cada nino, se revela la al mismo tiempo han buscado claves en los antiquisimos re- evidencia del antiguo nombre de Dios, oculto eOn el codigo gistros de quienes vivieron antes que nosotros: los pergaminos quimico de la vida misma? En el momento en que ese mensaje escritos, los muros labrados y los fragmentos de textos de la se compartiera, el mundo que hemos conocido nunca podria antigiiedad. A traves de la busqueda en bibliotecas de monaste- ser el mismo. rios remotos y en fragiles manuscritos que se transcribieron Imaginemos las implicaciones de descubrir que el Dios de tediosamente letra por letra, los descubrimientos que se han nuestras plegarias: el Ala del Islam, el Senor de las creencias logrado hasta la fecha, aunque son interesantes, no han res- judeo-cristianas, el Dios Supremo de las tradiciones hindues, pondido a las expectativas de los investigadores. Lo que existe, y el Gran Espiritu de los nativos americanos, es precisamente sin embargo, son claves para la soluci6n de nuestro misterio, el mismo Dios. Consideremos las antiguas heridas que po- que sugieren que los registros escritos de nuestropasado esran drian sanarse sabiendo que todas las persecuciones, limpiezas incompletos y solo revelan una porcion de algo cuyo alcance ernicas, guerras religiosas e inquisiciones que se,emprendieron es mucho mayor. en nombre de Dios a 10 largo de los ultimos dos mil anos jhan Desde los pasajes misteriosos ~egistrados en el Sepher Yetzi- surgido de un malentendido de este mensaje eterno! rah, el antiguo libro de la creacion de la Cabala, hasta la ins- Con la revelacion de tal descubrimiento, las razones que cripcion original que se Ida sobre la entrada principal del han justificado los horrores de nuestro pasado se volverian Templo de Apolo en Delfos, existen referencias a una clave obsoletas. A partir de entonees, la ignorancia ya no podria usarse universal-una capsula de tiempo de conocimiento- que con- para condonar atrocidades basadas en nuestras diferencias. A tiene la respuesta, olvidada desde hace tanto tiempo, sobre la traves de la evidencia innegable dellegado comun de la huma- identidad de nuestro Creador y el origen de nuestra especie. nidad, los conflictos en nombre de Dios solo podrian brotar Con esa clave, se nos dan los medios para zanjar las diferencias de la opcion de crear dificultades. En ese momento, empeza- de creencias, de legados 0 de herencia historica que alguna vez riamos de nuevo. hayan podido dividirnos. El tema de tales pasajes es decepcio- nantemente simple. Con la elocuencia dpica de muchas anti- Buscar [as respuestas correctas guas tradiciones, se nos invita a "conocernos" Ya "buscar en en [os [ugares equivocados nuestro interior", para encontrar respuestas a los misterios mas profundos. ~Existe una evidencia tan poderosa? ~Podria un registro del Tradicionalmente, los eruditos han visto estos pasajes como legado mas sagrado de la humanidad habet sobrevivido al tiem- metaforas, sugiriendo que mediante la experiencia de nuestra po y a los estragos de la civilizacion, esperando a ser descubier- vida adquiriremos la sabiduria de los siglos. Algunos argumen- to desde el amanecer de nuestra creacion? Durante mas de larian que las tribulaciones y los retos de la vida en el mundo 4,000 anos, los eruditos se han hecho este tipo de preguntas y moderno se han convertido. de hecho. en grandes maestros. 8 El C6digo de Dios Historia 9 Sin embargo, ~seria posible que la invitaci6n que se oos hace a cubrir que nuestra busqueda del pasado ha sido el catalizador "mirar en nuestro interior" sea algo mas? ~Podrian tales pasajes que nos ha guiado ala fuente de conocimiento mas antigua que tomarse en forma literal y leerse como instrucciones, verdade- existe, la biblioteca de la vida. ras instrucciones, que describen d6nde podemos encontrar la Se ha dicho que la clave de nuestro futuro esta en nuestro clave de nuestra creaci6n? pasado. El notable antrop610go, Louis Leakey, aclamado por Una nueva interpretaci6n de las invitaciones antiguas su- sus descubrimientos de antiguos homfnidos en el desfiladero giere que la clave para descifrar nuestros misterios podria en- Olduvai de Africa, dijo en una ocasi6n: "No creo que podre- contrarse dentro de 10 que nuestras tradiciones mas caras mos avanzar sin una comprensi6n de quienes somos, y de d6nde describen como el maximo logro de la creaci6n de Dios: jnuestra venimos". Mas tarde, en el siglo XX, el antrop610go Richard biologfa! En lugar de buscar entre los restos de templos des- Leakey, hijo de Louis Leakey, reiter61a importancia de los sen- gastados por el tiempo yen manuscritos que estan a punto timientos de su padre diciendo: "Para darle significado al pun- de desmoronarse, la respuesta a nuestros misterios mas pro- to en que nos encontramos ahora, necesitamos mirar de d6nde • " 1 fundos podria estar oculta dentro de laO expresi6n de la vida vemmos. mlsma. La historia es el relato de ese viaje. A 10 largo de las pagi- Conceptualmente, la idea de mirar al interior de la crea- nas del tiempo, hemos llevado un registro viviente de la busque- ci6n para buscar una evidencia de su creador no es muy dife- da de nuestra identidad, nuestra busqueda para saber quienes rente a una practica que es comun hoy en dfa. Desde la somos, y de precisamente c6mo encajamos en el esquema de construcci6n de complejos aparatos electr6nicos hasta la sen- la creaci6n. Nuestro legado se preserva como las naciones, las cillez dellienzo de un artista, el deseo de dar a conocer a otros familias, las guerras y los logros de quienes nos han antecedi- nuestros logros parece ser parte de la naturaleza humana. Al do; los bloques que construyeron nuestro pasado. En forma ver los autom6viles, los aparatos domesticos, la musica que colectiva, hemos dejado pocos lugares sin explorar pues he- mueve nuestras almas y las esculturas que nos inspiran sin pro- mos puesto a prueba los Hmites mismos de nuestros sentidos y ducir sonido alguno, s610 necesitamos ver la obra en sf para creencias en un esfuerzo por definirnos. descubrir la firma de su creador. Si una firma de nuestro Crea- Gran parte de nuestra historia refleja nuestro intento por dor ha sobrevivido a los elementos del tiempo y de la naturale- encontrar gracia en la presencia de un poder superior. Los enor- za, entonces seria muy 16gico que esa sefial permaneciera dentro mes templos en los desiertos de Egipto, los observatorios ocul- de nuestro cuerpo. tos en las selvas de Yucatan, los santuarios en las cumbres de El secreta para revelar esa firma es que debemos primero las montafias de Peru y las grandes catedrales de Europa, nos reconocer ·los principios universales que nos unen a nuestro recuerdan nuestros esfuerzos a 10 largo de la historia por agra- mundo, y 10 que tal vez sea mas importante, reconocer aquello dar y acercarnos a nuestra idea siempre cambiante de Dios. La que nos une como seres humanos. Al hacerlo, podriamos des- historia tambien nos recuerda las consecuencias que experi- 10 El C6digo de Dios Historia 11 mentaron individuos y poblaciones enteras que no estuvieron profundo es responsable de haber fraguado ~o que el hi~toria­ de acuerdo con las creencias de sus tiempos. dor Eric Hobsbawm llam6 "el siglo mas asesIDO que regtstra la historia" .2 Al deterrninar el numero de victimas de 10 que el llama Una especie que se define por sus diferencias "matanzas por motivos politicos", Zbiginew Brzezinski, quien En nuestro mundo de diversidades, a menudo ha sido mas fuera asesor nacional de seguridad de Estados Unidos duran- facil concentrarse en las diferencias que nos dividen que en los te la adrninistraci6n del presidente Carter, calcu16 que para principios que nos unen. Nuestra historia es la historia de una 1993, la violencia provocada por nuestras diferencias habria especie que se define por la religi6n, el color de la piel, la ri- costado entre 167 y 175 rnillones de vidas en el siglo XX; jmaS queza de las sociedades y al avance de la tecnologfa. A 10 largo o menos la poblaci6n de Gran Bretana, Francia e Italia combi- de los 4.5 miles de millones de anos que los ciendficos calcu- nadas!3 Ian ha existido nuestro mundo, nuestros ancestros humanos Junto con las batallas para zanjar disputas sobre fronteras y mas cercanos surgieron hace s6lo 250~000 anos. Durante ese recursos, el ultimo siglo fue testigo de horrores de diferente periodo relativamente breve, nos las hemos arreglado para se- tipo: el aparentemente implacable esfuerzo por "limpiar las nalar nuestras diferencias y transformarlas en barreras invisi- sociedades" basandose en principios que van mas alla de la bles de clase y de nivel social que impulsan nuestro sentido de tierra y la propiedad de recursos naturales. En 1948, la Asam- separaci6n. A partir de estas barreras, incontables miembros blea General de las N aciones Unidas escogi6 el terrnino geno- de la familia global han sufrido en formas que parecen impen- cidio para describir este tipo de violencia, definiendola c.omo: sables a la mente de personas racionales y amorosas. Juntos, "negarle a grupos humanos completos el derecho la eXlsten- compartimos las tinieblas de una historia llena de persecucio- cia". El articulo II de la Convenci6n de las N aciones Unidas nes, inquisiciones, esclavitud e intentos por eliminar razas en- sobre el genocidio defini6 mas a fondo cinco categorias de teras de la faz de la Tierra. genocidio en 10 que concierne a las poblaciones humanas: En la actualidad, estamos asombrados ante la tecnologfa aparentemente milagrosa que nos permite combatir la enfer- 1. Matar rniembros del grupo. medad y alargar nuestra vida hasta edades muy avanzadas. AI ') Causar dano grave corporal 0 mental a miembros del mismo tiempo, nos encontramos en un mundo donde la vida grupo. que tantas personas luchan por preservar, rutinariamente se ). I nflingir deliberadamente al grupo condiciones de vida di- extingue debido a las atrocidades ya la violencia de 10 que senadas para causar su destrucci6n fisica total 0 parcial. se ha llamado "la inhumanidad del hombre hacia el hombre". .L I mponer medidas cuya intenci6n es impedir nacimientos Aunque el desarrollo de armas de alta tecnologfa en el siglo que acaba de pasar hizo posible la destrucci6n de incontables en eI grup( l. vidas en un solo dia, la historia muestra que algo mucho mas :;,. Transf(:rir por la fller"a a 01 ro grllpo Ii los ninos del grupo. 12 E1 C6digo de Dios Historia 13 antes de los horrores del siglo XX. AI agregar las atrocidades del siglo XX en Europa, 10 que incluye el holocausto juelio de la Segunda Guerra Mundial; el holocausto de cristianos y ca- tolicos en Poloma durante la Segunda Guerra Mundial; y las limpiezas etmcas que han ocurrido en las regiones de los Bal- canes, Vietnam, Camboya, Laos, Africa y el Tibet, la cifra fa- cilmente excede los 53 millones. Figura 1.1: Numero aproximado de muertes'a causa de inquisiciones y episodios de genocidio. Aunque las cruzadas se llevaron a cabo antes de la epoca que se describe en este libro, se incluyen por motivos de compara- cion. Las estadisticas correspondientes a los Balcanes son conservadoras debido a la cantidad de muertes de civiles sobre las que no se informo, y bien podria ascender a 4.8 millones 12 • Los calculos se tomaron de prome- dios de registros historicos. Figura 1.2: Numero de muertes causadas por diferencias de religion y de creencias, por el SIDA y a causa de desastres naturales en el siglo XX. Los La forma de genocidio que se basa en diferencias de raza, desastres naturales incluyen sequias y hambrunas. religion y legado, y que es responsable por la magnitud de muertes sobre las que informan Brzezinky y otros, se llama Para poner estas abrumadoras cifras en perspectiva, aun- limpieza etnica. que el siglo que acaba de pasar es notorio por sus guerras san- Aunque la historia de estas persecuciones empezo mucho grientas, se perdieron cinco veces mas de vidas debido a la antes de la era moderna, el esfuerzo de casi 300 anos por ex- violencia basada en conflictos hnicos, religiosos y ftlosoficos si pulsar a1 nativo americano de sus tierras y eliminar su forma se les compara con los desastres naturales mas importantes y la de vida, fue 10 que inicio las tendencias actuales, y causo la cpidemia de SIDA combinados, durante ese mismo periodo magnitud de los genocidios que han continuado hasta nues- (ver la Figura 1.2). Aunque los historiadores por 10 general tros elias. (Figura 1.1). Entre el comercio de esclavos africanos estan de acuerdo en estas cifras, las cifras en sf son menos sig- en el Atlantico y los holocaustos de nativos americanos del nificativas que la magnitud del relato que representan. Quizas siglo XVII al XIX, casi 40 millones de seres humanos ya ha- l'S por esta razc'>n que cl siglo que acaba de pasar se conoce bfan pcrecido debido a diferencias de religibn, raza y legado, " como e1 I am I)Ien Sl~ ' 01qUl'"aca)o I' con Ia paz ,,1(, . 14 EI C6digo de Dios Historia 15 La paz es mas que la ausencla de guerra En el segundo afio del siglo XXI, las Naciones Unidas em- prendieron 15 misiones de paz, 10 que da un total de 54 mi- Las generaciones futuras van a estudiar al siglo XX como el siones desplegadas desde la creaci6n de la comisi6n en 1945 siglo mas violento de la historia escrita. En los primeros anos (Ver la Figura 1.3). En la actualidad, la mayoria de las misio- del siglo XXI, gran parte de la manera de pensar responsable de nes de paz de las Naciones Unidas se concentran en Europa esa siniestra caracterizacion parece persistir. Con el numero del Este, Africa y el Oriente Medio. creciente de programas de armas nucleares en paises como In- Aunque el prop6sito de las fuerzas de las Naciones Unidas dia, Pakistan, Iran y Corea del Norte, se esta preparando en el es proporcionar paz y estabilidad a una regi6n geografica espe- nuevo milenio el escenario para carreras armamentistas simi- dfica, la paz que proporcionan puede ser simplemente una lares a las de la Guerra Fria del siglo anterior entre Estados Uni- paz impuesta, en la que se reduce el co~flicto mediante un dos y la Union Sovietica. La amenaza del terrorismo, la guerra despliegue de poder. Ademas, la naturaleza internacional de civil y las diferencias religiosas hace indudable que la violencia y las fuerzas de las Naciones Unidas es un recordatorio de que el sufrimiento que desfiguraron al siglo·XX serin ellegado de desde una posici6n "oficial", la mayor parte del mundo apoya los primeros anos del nuevo milenio. a los guardianes de la paz, con la promesa de Hevar una presen- Aunque los intentos politicos por remediar el conflicto son cia militar aun mayor para resolver la situaci6n, si eso fuera siempre muy favorables, cuando esos intentos han fracasado , necesario. La historia tambien ha demostrado que a largo pla- el enfoque de retirada ha sido por 10 general un enfoque mili- zo, una paz impuesta por 10 general es ineficaz. Es obvio que el tar: superar las fuerzas de la tirania con una fuerza mayor cuyo numero y la duraci6n de estas misiones nos esta ensefiando proposito es impedir mas tirania. Estas fuerzas son precisa- una lecci6n poderosa. mente las que han estado presentes en lugares que van desde AI recordar la imagen de un globo Heno de agua que se Bosnia y Herzegovina hasta tierra Leone y el este de Timor. presiona con un dedo en un lugar y ve uno como su volumen crece en otro lugar, la represi6n de la violencia que brota del dolor y la ira en una parte del mundo no hace que el conflicto desaparezca. Aunque las tropas y las sanciones pueden ser muy eficaces en cuanto a impedir que haya violencia en una ubica- ci6n en particular, la tensi6n subyacente que es la ralz de esa violencia permanec~. No deberia sorprendernos ver que la ten- si6n de regiones enteras se vuelve aun mayor inmediatamente despues del uso de la fuerza para apagar los brotes de violencia. Desde esta perspectiva, las intervenciones militares podrian verse como una especie de "curita", una respuesta dpida a Una F4~ura 1.3: Misiones ddas Naciones llnidas a !ilvor dl'(a paz. aetivas en 21M 12. 1 • crisis inmediata mucho mas profunda. En e1 contexto de las 16 El C6digo de Dios Historia 17 condiciones actuales del mundo, tales respuestas p.odrian te- vida, experimentamos la espiral descendente de la competen- ner sentido si salvaran vidas a corto plazo. Por ejemplo, s610 cia violenta y la agresi6n. Desde la caida de Roma hasta el gracias ala intervenci6n de las fuerzas pacificadoras durante la colapso de la antigua Uni6n Sovietica, el hecho de olvidar esta crisis de Kosovo en 1999, se impidi6 el exterminio de aldeas y simple verdad ha destruido a algunas de las naciones mas po- comunidades enteras en la antigua Yugoslavia. No obstante, derosas de la historia. el constante conflicto entre Israel y los palestinos subi6 a nue- ~C6mo nos vemos a nosotros mismos al inicio de un nue- vas proporciones en los primeros anos del nuevo milenio. Esta vo siglo? La intensidad de las guerras de los ultimos anos del nueva ola de violencia ocurri6 incluso con la presencia militar siglo XX, las limpiezas etnicas y las luchas por el poder pueden en el area, 10 que ilustra el hecho de que la fuerza no puede ser elocuentes. Que tambien 10 sea nuestra respuesta global a traer una paz duradera. este tipo de crisis. Ya sea que hablemos de una familia a la hora de la cena 0 Hoy, la busqueda para conocernos continua. La forma en de todo el mundo, la verdadera paz es mas que simplemente la que vivimos cada dia es un eco de nuestro anhelo por encon- ausencia de conflictos. La paz duradera Dcurre en el coraz6n y trar un significado mayor en nuestra vida. Como una tribu en la mente de las personas, antes de que ocurra entre los go- que ha caminado errante durante tanto tiempo que ha olvida- biernos y las naciones. Aunque los esfuerzos de pacificaci6n en do el prop6sito de suviaje, nosotros, en las acciones del vivir, el mundo entero podrian ser criticos en cuanto ala prevenci6n buscamos una senal, algo que Ie de significado a 10 que hemos de la violencia a corto plazo, y proporcionar un paso vital ha- creado y a 10 que hemos llegado a ser. cia una soluci6n pacifica de cualquier conflicto, al final es poco 10 que pueden hacer, ademas de comprar tiempo precioso. La La busqueda de nuestro [ugar en [a creaci6n cuesti6n se convierte en saber si en ese tiempo tendremos 0 no la sabiduria para encontrar otra forma de resolver los proble- EI 28 de abril de 2001, un hito en la busqueda que nos lleva a mas que nos dividen. comprender nuestro lugar en el cosmos vino y se fue sin mu- Aunque la respuesta a esta pregunta s610 se revelara en el cho bombo y platillo. Excepto por una breve menci6n en las futuro, debemos estar seguros de algo: Podemos aprender de noticias vespertinas, el suceso que ocurri6 mas temprano ese nuestro pasado. Cada conflicto, cada guerra e intento de lim- dia pas6 desapercibido. A las 10:27 a.m., hora del Pacifico, los pieza etnica, puede verse como un espejo de nuestra relaci6n cientificos que trabajaban con un radio telescopio muy sensi- con nuestro Creador, de nuestras relaciones interpersonales, y ble en Madrid, Espana, recibieron una senal del primer objeto de nuestras relaciones con la creaci6n misma. Cuando valora- hecho por el homb~e que sali6 de nuestro sistema solar. Como mos la vida y nos vemos como miembros de una familia glo- no se habia recibido comunicaci6n alguna de ese aparato des- bal y administradores de la Tierra, nuestras acciones revelan de agosto de 2000, el dia anterior los cientificos de la Admi- esas creencias. La historia ha mostrado que cuando optamos nistraci6n de Aeronautica y el Espado (NASA) habian por deshonrarnos unos a orros y deshonrar al principio de la rransmirido una selial hacia la vasredad del espacio profundo, 18 El C6digo de Dios Historia 19 en un esfuerzo por iniciar el contacto con el objeto desde la tormentas radioactivas, y de soportar las gelidas temperaturas Tierra. Viajando a la velocidad de la luz, la sefial reg~es6 y fue bajo cero del espacio profundo, el Pioneer todav!a estaba "vivo" captada por el telescopio de Madrid. Con esa sefial se renov6 y sus instrumentos todav!a funcionaban. Aunque la misi6n de la fe en ellegado del Pioneer 10, una sonda espacial que habla la sonda espacial podria continuar durante cientos de afios hacia sido lanzada desde la Tierra hada tres decadas. el futuro, las distancias que ha recorrido haran que a la larga El 2 de marzo de 1972, el Pioneer 10 inici6 una travesla sin ese tipo de comunicaci6n no sea practico. precedente que finalmente 10 llevada a los limites de nuestro sistema solar y mas alIa.. La tarea del Pioneer era mandar infor- maci6n a la Tierra a 10 largo de su travesla, dando a los cientl- ficos nueva comprensi6n sobre los campos magneticos, la gravedad y los patrones climatol6gicos de nuestros vecinos, los C!)-.C!) / planetas distantes; datos que nos ayudadan en !1uestra bus- , / queda de quienes somos. Sospechando que la nave podria en- contrar vida inteligente en algun punto de su viaje sin retorno, , \ 1/ se equip6 al Pioneer con nuestra primera "tarjeta de presenta- ci6n" interestelar. ",\.11:----- ~;~7-f~ ...- Se anex6 a la pequefia nave una placa de oro de seis por nueve pulgadas, disefiada por el fallecido Carl Sagan y por el Dr. Francis Drake, con informaci6n vital sobre sus creadores y I sobre su origen. En la superficie de la placa se grab6 cuidado- samente un diagrama que indicaba que el origen del Pioneer era el tercer planeta del Sol y que muestra su relaci6n con el o -. o o -- • resto de la galaxia. Entre la informaci6n adicional que contie- ne, hay imagenes de un hombre y una mujer, la silueta de la nave Pioneer y sfmbolos qufmicos que demuestran que com- Figura 1.4: Ilustraci6n esquematica de la placa de oro que lleva la nave prendemos la estructura del hidr6geno, que es el elemento mas Pioneer 10. abundante en el universo (Ver la Figura 1.4). En algun punta.de su viaje, bien podda el Pioneer encon- La sefial que regres6 a la Tierra ese dla de 2001 fue la mis- trar seres vivos inteligentes que, como nosotros, buscan indi- rna sefial que se habfa transmitido desde la Tierra 22 horas cios de sus origenes y de otros seres de su misma clase. Ese dfa, antes (El Pioneer estaba a una distancia de casi a 11 afios luz, despues de haber viajado tan lejos de nuestro hogar, con evi-, as! que la sefial se tard6 11 horas en llegar y otras 11 horas en dencia de nuestra existencia, la sonda, de 570 libras de peso, regresar). Despues de 29 afios de eludir pardculas espaciales y El C6digo de Dios Historia 21 20 que sali6 de nuestro mundo en la primavera de 197.2 se con- para la existencia de vida inteligente. Recurriendo a suposicio- vertira en nuestro primer embajador en el espacio profundo. nes eruditas, como la tasa de formaci6n de estrellas al ano, y el Aunque quienes 10 descubran no entiendan los sfmbolos, la nUmero de esas estrellas que producen planetas adecuados para mera existencia del Pioneer habla por sf misma. El hecho de la vida, la ecuaci6n de Drake sugiere que podrian existir hasta que su unica misi6n es la exploraci6n, deberia indicar a quie- 10,000 civilizaciones inteligentes en el universo, tal y como 10 nes 10 descubrieran que nosotros valoramos la vida a tal grado conocemos, (ver la Figura 1.5).20 que estamos dispuestos a aplicar nuestra tecnologfa, y llegar hasta las regiones inexploradas de nuestro sistema solar y mas alla, para saber si hay alguien mas "alla fuera". ISomos [os unicos? Despues de su alunizaje en 1969, Neil Armstrong, el primer ser humano de la historia escrita que puso el pie en otro mun- do, admiti6 que aunque hasta la fecha no tenemos ninguna prueba, es muy posible que exista vida inteligente en otro lu- gar. "Si extrapolamos, basandonos en la mejor informaci6n que tenemos, debemos llegar a la conc1usi6n de que es proba- ble que exista vida alla fuera; y quizas en muchos lugares". 18 Otros eientfficos e investigadores respetados en su campo, hacen eco al sentimiento de Armstrong. "Sabemos que hay planetas alrededor de otras estrellas, y sabemos que es posible Figura 1.5: La f6rmula del astr6nomo Frank Drake para calcular el nUmero que algunos de esos planetas tengan las condiciones propicias de civilizaciones inteligentes que podrian existir en nuestro universo. Obser- vaci6n: En esta ilustraci6n, la letra x es el simbolo de la multiplicaci6n. para la vida. De modo que seria muy extrano que fueramos los unicos. Es mucho mas probable que el universo este lleno de vida", dice Dan Werthimer, un fisico de la Universidad de Por el momento, sin embargo, a1 parecer somos Unicos en California en Berkeley.19 la vasta extensi6n del cosmos. En la actualidad los cientificos En 1961, el astr6nomo Frank Drake propuso una ecua- creen que el universo en que habitamos tiene una extensi6n de ci6n con la que es posible calcular el numero de civilizaciones 17 billones de anos luz de un extremo al otro (1 ana luz equi- inteligentes que podrian existir en otros puntos de nuestro vale a los 9.46 trillortes de millas que la luz recorre en un ano), universo. Esta f6rmula se conoce como la ecuacion Drake, y se \' "\Ue la galaxia de la Via Lactea en si tiene una extensi6n de basa en siete factores que los cientificos consideran necesarios )()(),()()O a~os luz. Se calcula que en todo el universo existe la 22 El C6digo de Dios Historia 23 abrumadora cantidad de 200 billones de galaxias y que cada que tal vez sea el enigma mas antiguo y mas dificil de todos... una de elias tiene, como la nuestra, de 200 a 500 estrelias aproxi- debemos descubrir quienes somos, mirando en nuestro in- madamente. tenor. Con estadlsticas tan sobrecogedoras, existe la posibilidad de que existan seres inteligentes en algun lugar. Algunos inves- RESUMEN DEL CAPITULO 1 tigadores incluso sospechan que ya nos hemos puesto en con- tacto con elios de una u otra forma. A pesar de no tener datos • En los primeros arros del siglo XXI, la humanidad se concretos al respecto, muchas personas simplemente tienen enfrenta a los mayores retos de la historia. La posibi- una profunda intuici6n, que se describe como un "saber", de lidad de una tercera guerra global, las enfermedades que no estamos solos. En ese saber se encuentra el sentido que se resisten a todo medicamento, y los resultados de una presencia universal superior que se relaciona con Dios. inciertos de las tecnologlas biol6gicas como la clona- Aunque descubramos que esa presencia no es "el Dios", 10 que ci6n humana, amenazan ahora el futuro de toda la se espera es que al encontrar otros seres vivos nos acercaremos espeCle. a la soluci6n del misterio de nuestro propio origen. • A pesar de tener la ciencia mas avanzada de la histo- Al comentar sobre el valor de nuestra busqueda de otros ria, aun no hemos respondido una pregunta que po- seres vivos, Carl Sagan observ6: "En el sentido mas profundo, drla ser la mas fundamental de nuestra existencia: la busqueda de una inteligencia extraterrestre es una busque- ~Quienes somos? da de nosotros mismos". 21 Quizas el fundamento del sentimien- • La historia es el relato de nuestra busqueda para co- to de Sagan brota de la probabilidad de que la busqueda de nocernos. Nuestro viaje esta lleno de ejemplos de la nuestro origen nos llevara finalmente ala evidencia mas abun- manera en que las diferencias de raza, de creencias, dante del misterio de la vida: ~l misterio de la humanidad. de legados y estilos de vida se han utilizado como la Aunque es muy posible que exista vida inteligente en otro base de las atrocidades que se conocen como "la in- lugar del universo, por el momenta la familia de los seres hu- humanidad del hombre hacia el hombre". manos parece ser la unica en la creaci6n. Aunque se descubrie- • Los historiadores reconocen que el siglo XX fue el ra una presencia viviente mas alIa de nuestro mundo y se Ie siglo mas sangriento de la historia. Se perdieron mas reconociera abiertamente, es posible que no sea identica a no- vidas por genocidios y limpiezas etnicas que debido sotros. Es muy probable que no cambie nuestra condici6n como a desastres naturales y a la epidemia de SIDA, du- una forma de vida unica en su especie. Ala luz de nuestro rante ese mismo periodo. carcicter unico, tal vez descubramos que las cualidades que nos hacen tan distintos encierran tambien la clave de nuestra su- • Muchos de los problemas que subyacen la violencia pervivencia ante las gFandes amenazas de nuestro futuro. Pero del siglo que acaba de transcurrir siguen estando pre- para encontrar esa clave. debemos primero enfrentarnos a 10 sente~ hoy en dfa. Como no se han resuelto, han lle- 24 El C6digo de Dios gado a niveles regionales y ahora amenazan la paz de nuestro mundo. • La tecnologla de los ultimos 50 afios nos ha llevado ala busqueda de nuestra identidad en las regiones mas lejanas de nuestro sistema solar y mas alia. £1 Pio- neer 10 continua su viaje sin precedente hacia el es- pacio profundo con una placa de seis por nueve pulgadas disefiada como nuestra primera "tarjeta de presentaci6n" interestelar. • Finalmente, la busqueda de nuestros odgenes parece llevarnos ala Fuente mas abundante de claves: la vida misma. AI comprender la vida en general, y al saber espedficamente quienes somos, poddamos descubrir la forma de superar las diferencias que amenazan nuestra existencia. Capitulo Dos HUESOS, LIBROS Y CELULAS: Cuando [as eVldenclas y [as teorias chocan E n los primeros afios del siglo XXI, enfrentamos una reali- dad unica que provoca en nosotros un sentimiento de humildad. En 10 que podrfa ser la mayor de las ironfas, aunque tenemos en nuestras manos la ciencia mas avanzada de la histo- ria de nuestra especie, todavfa no hemos respondido ala pre- guma mas basica de nuestra vida: ~Exactamente quienes somos? ~Debemos nuestra existencia a la evolucion y a una combina- cion al azar de elementos, 0 hay algo mas en nuestra vida? En busca de nuestro origen Hasta tiempos recientes, las discusiones ciendficas sobre el ori- gen del hombre se han basado en gran medida en los hallazgos de restos fosilizados que se cree corresponden a nuestros ante- pasados. De acu~rdo con la teorfa de la evoluci6n de Charles Darwin, publicada por primera vez en 1856 como Elorigtn tk 28 El C6digo de Dios Huesos, libros y celulas 29 las especies mediante la seleccion natural, la idea general es que Contrario a la interpretacion cientffica sobre la edad de la las especies se desarrollan a 10 largo de periodos muy largos y Tierra y a los registros geologicos que se aceptan hoy en dfa, el que cada generacion elige de sus progenitores las caracteristi- creacionismo declara que toda vida fue creada al mismo tiem- cas que garantizan su supervivencia. En esta forma, los rasgos po por la fuerza de Dios durante el periodo de "el principio". que producen fuerza y diversidad en los individuos se preser- Ademas, esta teorfa wrma que esencialmente no es posible van y se fomentan. Gran parte de la teoria de Darwin se basa encontrar nuevas especies. Todos los seres vivientes que exis- en observaciones que el hizo mientras estudiaba la vida silves- ten en la actualidad 0 que existieron en el pasado, incluyendo tre en las islas Galapagos, al igual que en sus hallazgos de cria- a la vida humana, son el resultado de la creacion original, y turas fosilizadas que eran desconocidas para el mundo cuando han permanecido fijos y sin cambio. el realizo sus expediciones. Para explicar los rasgos ffsicos que forman actualmente ala Antes de la publicacion de la obra de Darwin, el punto de Tierra, los seguidores del creacionismo buscan en el pasado vista predominante sobre la forma en que nuestro mundo lle- sucesos de proporciones catastroficas. A este concepto, conocido g6 a existir era el resultado de una interpretaci6n literal del como "catastrofismo" se Ie atribuye la creacion de las monta- relato bfblico del Genesis. Este punto de vista sigue siendo nas, oceanos y continentes que vemos en la actualidad. La vi- popular en la actualidad y se Ie reconoce como la teoria del si6n del mundo que se basa en las teorfas del creacionismo y el creacionismo, cuyas rakes se encuentran en la doctrina reli- catastrofismo se mantuvieron practicamente intactas hasta giosa propuesta por el Obispo Anglicano James Ussher en 1701. 1785, cuando se publico la obra del cientffico escoces James Combinando la historia mediterranea y del oriente medio con Hutton; una obra capaz de hacer pedazos un paradigma. las fechas historieas de nacimientos y muertes que aparecfan A Hutton se Ie conoce como el padre de la geologfa moderna en la Biblia de su tiempo, el Obispo Ussher cre6lo que supuso y su libro, La teoria de la Tierra, sugiere que nuestro mundo esta era una cronologfa exacta de los sucesos bfblicos desde el pri- cambiando y evolucionando constantemente como resultado mer dfa de la creacion. de procesos naturales que siempre han existido, y no como resul- Basandose en sus calculos, Ussher declaro que el domingo [ado de una linica intervencion divina que ocurrio en el "princi- 23 de octubre del ano 4004, antes de la era comlin, era el pio". Las teorfas de Hutton tambien wrman que las fuerzas que dfa del "Principio", 10 que indicarfa que la Tierra tendrfa una actuaron antiguamente en la historia de nuestro planeta siguen edad de 6000 anos. 1 Luego, basandose en esta cronologfa, activas, y que los procesos continlian hasta el presente. La natu- Ussher calcu16las fechas de los sucesos bfblicos mas importan- raleza continua de estos cambios es 10 que puede ofrecer a los tes, como la expulsion de Adan y Eva del Parafso, que el investigadores modernos una ventana hacia el pasado. 2 Aun- sena16 como ellunes 4 de noviembre del ano 4004 antes de la que estos principios nos parecen obvios en la actualidad, teo- era comlin. Las co-relaciones de Ussher se imprimieron como das como las de Hutton fueron revolucionarias en su epoca. versiones autorizadas de la Biblia y muchas personas las acep- Darwin estaba familiarizado con el trabajo de Hutton y taron sin titubear. orros cientificos. 3' Y sus ideas conrribuyeron a su teoria de la 30 El C6digo de Dios Huesos, libros y celulas 31 evoluci6n al proporcionar una explicaci6n para 10 que el vio resultado de su trabajo como las teorfas de seleccion naturaly la durante su famoso viaje en el HMS Beagle de 1831 a 1836. evolucion. En esencia, estas teorfas simplemente afirman que A 10 largo de su travesfa, Darwin observ6 una variedad mas existen difereneias en cualquier poblaei6n. Sus miembros y grande de plantas y animales que ningun cientffico de su epo- descendientes que tienen caracterfsticas que apoyan su vida, ca. Una nota escrita en su diario en 1859, en la que recuerda como picos grandes para comer nueces de gran tamano 0 co- este viaje, nos da una idea de la impresi6n que Ie caus6 a nivel lores que actuan como camuflaje y protecei6n, tienen ventajas personal: sobre otros miembros de esa misma especie que no tienen es- tas caracterfsticas. "Estando a bordo del HMS Beagle como naturalista, me AI paso del tiempo y de condiciones cambiantes, los indi- impresionaron mucho ciertos hechos relacionados con la viduos con caracterfsticas que aseguran su superviveneia triun- distribucion de los habitantes de America del Sur, y la rela- fan sobre los miembros que carecen de elIas. La raz6n es que cion geologica entre los habitantes del pasado y del presen- sobreviviran durante mas tiempo y tendran descendientes te en ese continente. Estos hechos paredan darme algo de que tambien presentaran las caracterfsticas deseables. A la lar- luz sobre el origen de la especie, ese misterio de misterios, ga, cambios que en un principio eran unicos en los indivi- como 10 han Hamado nuestros mas grandes filosofos."4 duos, llegan a ser las caracterfsticas de toda una nueva espeeie. En un libro posterior, La descendencia del hombre, Darwin ex- Un elemento central de los hallazgos de Darwin fueron sus presa su creencia de que la humanidad, como otras formas de observaciones de diversas especies de aves en las Islas Galapa- vida, es el resultado de estos mismos procesos y que la selec- gos. No fue sino hasta su regreso a Londres que se dio cuenta ci6n evolutiva ocurre a 10 largo de extensos periodos. de que originalmente habfa pensado que eran espedmenes de familias diferentes de pinzones (aves de alas puntiagudas, cola lEvoluci6n 0 adaptaci6n1 larga, pieo ancho y vistoso plumaje en los machos) cuando eran en realidad variaciones de la misma familia. La cuesti6n a Aunque Charles Darwin regres6 de su hist6rico viaje en 1836, la que Darwin se enfrentaba era c6mo explicar variaciones como dio a conocer publicamente sus descubrimientos 20 afios mas el tamano y la forma del pico en pinzones que se habfan desa- tarde. En un ardculo del que fue co-auror, La teorfa de fa evo- rrollado aislados de otros en diferentes islas. El descubrimien- lucion y fa seleccion natural, presentado a la Sociedad Linnean to adicional de restos fosilizados de criaturas similares a animales de Londres, Darwin dio a conocer sus descubrimientos junto modernos, aunque mucho mas grandes, increment61a magni- con Alfred Wallace, un cientffico que habfa llegado a conclu- tud del misterio que enfrentaba Darwin. siones similares, aunque no contaba con evidencia para apo- Utilizando s61idos metodos ciendficos, Darwin aplic6 las yarlas. En El origen de las especies se public6 una versi6n mejores teorfas de su epoca para explicar 10 que habfa descu- completa de la teorta de Darwin que fue muy aclamada por bierto durante su hist6rieo viaje. Hoy en dta conocemos eI ciendficos de todo eI mundo. 32 EI C6digo de Dios Huesos, libros y celulas 33 Aunque el trabajo de Darwin estuvo bien pensado, docu- que en personas que todo el tiempo viven en altitudes consi- mentado meticulosamente y llevado a cabo de acuerdo a las derables la cantidad de gl6bulos rojos podria exceder hasta en directrices del metodo cientifico, ahora una creciente evidencia un 30 por ciento a la de quienes viven al nivel del mar. 5 sugiere que esposible que no describa en su totalidad fa historia de En general, quienes viven en estas altitudes extremas cam- los or/genes del Hombre 0 pruebe que el Hombre sea resultado de fa bian las funciones de su cuerpo de tal manera que puedan evolucion. Esto no significa que no haya ocurrido cierta forma sobrevivir en condiciones de baja temperatura, poca humedad de evoluci6n, ya que las caracteristicas que permiten que los y bajo ·nivel de oxigeno en la atm6sfera. Un incremento de grupos humanos se adapten a su entorno son bien conocidas y gl6bulos rojos aumenta la capaddad de la sangre para trans- estan bien documentadas. Quizas la capacidad de adaptarse, portar oxigeno y tambien la cantidad de oxigeno que se man- y no el proceso de evoluci6n, describa mejor 10 que se ha ob- da a los tejidos. Aunque estos estudios y otros similares servado en esos grupos. ciertamente documentan la capacidad de los grupos humanos Por ejemplo, las tribus de las regiones polares en el Artico y para adaptarse a su entorno, en realidad no llegan a revelar un Siberia han desarrollado mas carnosidad alrededor de los ojos, proceso evolutivo en 10 relacionado con nuestros origenes y 10 cuallas protege del brillo perpetuo del sol al reflejarse en la nuestra historia. nieve y el hielo y que dia con dia les espera al salir de su hogar. Aunque se cree que esta caracteristica es una respuesta directa l La evidencia apoya a la evoluci6n1 a su entorno, solo es un cambio en su apariencia. Los miembros de dichas tribus han vivido en el rudo en- Teniendo en mente las teorias de Darwin, la busqueda de nues- torno de las regiones polares al menos durante los ultimos diez tros origenes se ha concentrado en una busqueda de eviden- mil afios y se han adaptado a ellas. En ese tiempo, sin embar- cias fisicas para encontrar el vinculo entre los seres humanos go, no han evolucionado para convertirse en una nueva espe- modernos y nuestros ancestros mas lejanos. Un creciente cor- cie de ser humano, y al parecer no existe evidencia de que 1 pus de evidencia que se ha compilado a 10 largo de los ultimos alguna vez 10 haran. En el aspecto genetico, estos pueblos si- 150 afios, parece sugerir que nuestros ancestros si cambiaron guen perteneciendo a la especie Homo sapiens sapiens. Su cuer- progresivamente a 10 largo de grandes periodos, pasando de po simplemente se ha adaptado a las condiciones del entorno formas de vida menos avanzadas a formas de vida mas sofisti- que su mundo les presenta. cadas. Invariablemente, las discusiones sobre registros de f6si- De manera similar, existen documentos segun los cuales el les llevan a los estudios realizados por la familia Leakey de cuerpa de quienes viven en las regiones mas elevadas de la Kenia. tierra ha desarrollado caracteristicas que favorecen su supervi- Durante mas de medio siglo, los Leakey y sus colegas cien- vencia. Las cordilleras mas altas del mundo incluyen a los An- dficos, como Tim White y Donald Johanson, han trabajado des en el sur de Peru y al Himalaya que se eleva a grandes en las lejanas regiones del Valle Rift en el este de Africa tratan- alturas entre Nepal y el Tibet. Existen estudios que muestran do de encoptrar los eslabones faltantes en nuestro arbol genea- 34 El C6digo de Dios Huesos, libros y celulas 35 16gico. Desde que se iniciaron las excavaciones enla decada de mas de primates menos desarroliados, ~como explicamos los 1950, varios equipos internacionales han trabajado entre tierra registros de fosiles que muestran que hemos vivido con esas suelta y granos de polvo para recuperar fragmentos de hueso, formas de vida durante los mismos periodos? Suponiendo que dientes, utensilios de piedra, yen ocasiones secciones comple- la especie humana haya evolucionado gradualmente a traves tas del esqueleto de seres antiquisimos que al parecer tienen del tiempo, ~que hizo que eaminaramos ereetos? Dos deseu- caracteristicas humanas. Muchas publicaciones del National brimientos de ftnales del siglo XX podrian empezar a clarificar Geographic han documentado meticulosamente esa busque- la razon por la eual existen estas preguntas, y 10 que las res- da que ha tenido lugar a 10 largo de medio siglo y que ha esta- puestas a elias podrian deeir sobre nuestra historia. blecido la fecha aceptada del origen del Hombre como casi seis millones de afios (Nature, 12 de julio de 2001). La busqueda continua hoy en dia y se han encontrado nu- merosos ejemplos de restos fosilizados que se cree representan diversas etapas en el desarrollo humano en la escala de la evo- 1uci6n. En los salones de clase de todo el mundo se habla de estos antiquisimos ejemplos de hominidos y por 10 comun se les denomina "el hombre de Cro-Mafi6n" y "el hombre de Neanderthal,,6. Adernas de establecer la fecha aceptada de los origenes de nuestros ancestros a una fecha 4 millones de mos antes de 10 que antiguamente se crda, los descubrimientos re- cientes en el este de Africa han incrementado de manera signi- ficativa nuestra comprensi6n de c6mo llegamos de "alIa" hasta "aqui". Una versi6n de la secuencia aceptada del desarrollo humano se muestra en la Figura 2.1. A pesar de 10 impresionantes que son estos hallazgos y otros similares, y de 10 mucho que contribuyen al conocimiento de nuestros origenes, los descubrimientos de finales del siglo XX han dado origen a nuevas preguntas, y en algunos casos han hecho que el misterio de nuestro pasado se haga mas profun- do. Por ejemplo, si el proceso de cambio es constante, ~por Figura 2.1: Una eronologia de nuesttos aneesttos ampliamente aeeptada; que la forma y la capacidad del cerebro del hombre moderno se interpreta a partir de evideneias fosilizadas. Este resumen es aproxima- permaneci6 virtualmente sin cambios durante los ultimos do, pues los nuevos deseubrimientos siguen eambiando las fee has CJue 160,000 a 200,000 afios? Si nos desarrollamos a partir de for- dcscribcll hI cdad tit- Ilucstros allccstrlls mas antiguos. 36 El C6digo de Dios Huesos, libros y celulas 37 El misterio gene-tico que se encuentran en las regiones polares. Este inusual estado de preservaci6n fue 10 que permiti6 la comparaci6n del ADN James Watson y Francis Crick establecieron el primer mapa de un nifio de treinta mil afios de antigliedad con el de seres que describe el bloque de construcci6n de la vida en 1953. humanos actuales. Tambien fue la primera vez en que este tipo Gracias al ahora famoso modelo de la helice doble y los patro- de pruebas pudieron llevarse a cabo en un cuerpo cuya anti- nes de informaci6n contenidos en la molecula de ADN, se gliedad ya se habia determinado mediante el carbono. abri6 la puerta a toda una nueva ciencia que identifica a los Aunque los cientfficos todavia estan bajo el impacto de las individuos basandose en caracteristicas geneticas unicas. Des- implicaciones de este informe, el estudio descubri6 que la po- de el color de los ojos y el cabello, hasta el genero y las tenden- sibilidad de un vinculo genetico entre el Neanderthal y los se- cias a ciertas condiciones de salud y enfermedad, los c6digos res humanos modernos era remoto. Los estudios sugieren que que determinan la apariencia y funciones de nuestro cuerpo "el hombre moderno en realidad no desciende del Neander- estan en el plano de nuestro c6digo genetico. A partir del des- tal". 10 Aunque en teoda, la ciencia de la comparaci6n genetica cubrimiento de Watson y Crick, la. ciencia 'de comparar seg- deberia resolver el problema de nuestros origenes, los resulta- mentos de ADN para determinar la paternidad, para identificar dos de hecho estan planteando mas preguntas y abriendo la personas desaparecidas y sefialar vinculos entre un indiv~duo y puerta a un territorio "prohibido" en 10 relativo a nuestro lina- un crimen espedfico, se ha convertido en un elemento Vital en je evolutivo y nuestros origenes. el anaIisis de escenarios de crimenes y en estudios forenses. Se ha revelado un misterio adicional a partir del descubri- En el afio 2000, las mismas tecnicas que se utilizan en ese miento del c6digo genetico en 10 relacionado con el numero tipo de investigaciones, cuyos resultados ~on recono~idos en de cromosomas que distinguen una especie de otra. En el inte- los tribunales de mas alto nivel en la actualldad, se aphcaron al . rior de los cromosomas de cada miembro de la especie hay estudio de los odgenes del hombre, por segunda vez en la his- / instrucciones biol6gicas que determinan la estructura 6sea, el toria. En un informe publicado en la prestigiosa revista Natu- tamafio del cerebro, los procesos metab61icos, etcetera. Los re,9 los investigadores del Centro de Investigaci6n Humana de ; primates superiores, como los simios y monos, tienen 24 pares la Universidad de Glasgow describieron su investigaci6n com- ! de cromosomas, es decir, un total de 48, 10 que les da su carac- parando material genetico de nuestros posibles ancestros con '" ter unico. Los seres humanos tienen 23 pares, jlo que da un el de seres humanos modernos. Junto con colegas de Rusia y . total de s610 46! Aunque parece que nos falta todo un juego de Suecia, los ciendficos analizaron el ADN del cuerpo de un cromosomas cuando se nos compara con nuestros parientes infante Neanderthal excepcionalmente bien preservado que se mas cercanos, un estudio comparativo de nuestros mapas ge- descubri6 en una cueva de piedra caliza en el norte del Caucaso. ' neticos revela un detalle interesante. El excepcional estado del cuerpo del nifio es en si una ~is­ Un analisis mas meticuloso de los cromosomas que pare- toria y un misterio. Normalmente, ese grado de preservac16n cen estar ausentes en nuestros genes, muestra que el cromoso- ocurre s610 en restos en que los tejidos se congelan, como los rna 2 de los seres humanos es muy similar y de hecho I 38 EI C6digo de Dios Huesos, libros y celulas 39 "corresponde" alos cromosomas 12 y 13 del chirppance, como derno, ison muy similares! Si el proceso evolutivo esta ocu- si estuvieran combinados (fundidos) en un trozo unico y mas rriendo, ~entonces por que aparentemente hemos cambiado grande de ADN. ll , 12, 13 Investigaciones adicionales sobre los tan poco durante un periodo tan grande? mapas geneticos de los primates indican que este "cromosoma Aunque este tipo de hallazgos a la larga planteen mas pre- humano 2 dividido" tambien es comun al gorila y al orangu- guntas de las que responden en la actualidad, cada etapa de la ran. Debido a estas diferencias en los cromosomas, no es pro- investigaci6n agrega algo a 10 que sabemos sobre nosotros mis- bable que procesos naturales 0 cruzas de epocas antiguas hayan mos, definiendo mas a fondo nuestro lugar en el universo y creado una mezcla genetica de ese tipo. Ademas de estos mis- nuestro papel en la creaci6n. Evidencias adicionales en 10 rela- terios del cromosoma 2, varias otras caracteristicas entre los cionado con registros de f6siles, dan credibilidad a los estudios genes del ser humano y los del chimpance parecen ser casi geneticos y sugieren que aunque quizas compartamos el ADN identicas, pero invertidas, entre las especies. 14 Ahora estos des- con formas de vida menos evolucionadas, tal vez nos hemos cubrimientos plantean esta pregunta: ~Que pudo haber suce- desarrollado de una manera unica e inesperada, con nuestra dido en nuestro pasado distante pata producir tales cambios propia linea de tiempo genetica. en el c6digo fundamental de nuestra vida? Con base en una comparaci6n entre la fisiologia humana y Anomalfas en el registTo de f6siles la de otros primates, existen crecientes evidencias que sugieren que, como Homo sapiens, somos una especie unica. En lugar Ademas' de los estudios de ADN, varias revistas cientificas han de ser parte de una progresi6n lineal que desciende de formas I' informado de descubrimientos de restos humanos an6malos; anteriores de primates, esta teoria adopta el punto de vista de esqueletos totalmente modernos en los mismos estratos de tierra que nos desarrollamos al mismo tiempo que los primates mas en que se encuentranfiJsiles de homfnidos muy antiguos correspon- antiguos en una especie de evoluci6n paralela. Una compara- I dientes a etapas mas lejanas en la escala evolutiva. En un informe ci6n entre las caracteristicas de los primates y los humanos, publicado en 1913, el Dr. Hans Reck, contemporaneo de Louis como la densidad de los huesos y nuestra capacidad de derra- Lakey, describi6 un hallazgo suyo en la misma zona de .Africa mar lagrimas, sudar y tener una cabellera en lugar de un pelaje que posteriormente revelaria los 'ejemplos mas antiguos de res- 15 que cubra todo nuestro cuerpo, da credibilidad a esta teoria, y [OS similares a los humanos. Trabajando en el Desfiladero al mismo tiempo fomenta la controversia ante quienes propo- Oldubai, el Dr. Reck descubri6 10 que pareda un esqueleto nen tanto el creacionismo como la teoria de la evoluci6n. h umano totalmente moderno y completamente desarrollado, En la revista britanica Nature (12 de octubre de 2003), se que se excav6 de las mismas formaciones geol6gicas en que se public6 un articulo que revela el descubrimiento de craneos cncontraron el "Hombre de Pekin" yel "Hombre de Java". fosilizados del Homo sapiens mas antiguo. Los restos, encon- La ubicaci6n fisica de un esqueleto moderno en los mis- trados en la regi6n media de Awash en Etiopia, datan de hace mas estratos donde se encuentran restos mas antiguos, plantea 160,000 anos, y aunque no son identicos al ser humano mo- lin problem; para la teoria convencional de la evoluci6n: Si 40 EI C6digo de Dios Huesos, libros y celulas 41 una forma de vida desciende de otra, no pueden ~oexistir en el cos". Las teorfas de como la creacion y la evolucion podrfan mismo periodo. Como los estratos mas profundos se deposita- explicar el origen de la vida, que se han propuesto hasta la ron antes, se puede suponer razonablemente que 10 que se en- fecha son precisamente eso: teorfas. Cada una esta disefiada cuentra en ellos es mas antiguo que cualquier cosa que se para explicar la evidencia que se observa desde una perspectiva encuentre en estratos menos profundos que se formaron en muy distinta. Durante las epocas historicas en que se introdu- una epoca posterior. jeron el creacionismo y el evolucionismo, ambas paredan dar A partir de estos procedimientos, que generalmente se acep- explicaciones razonables basadas en la informacion que se te- tan como un metodo de fechar objetos enterrados tomando nia disponible. Aunque las dos brotan de observaciones sensa- en cuenta la relacion que existe entre ellos, se puede llegar a la tas, una teorfa solo puede ser tan buena como la informacion conclusion de que los esqueletos de apariencia moderna ten- en que se basa. Es obvio que en 10 que concierne tanto al crea- drfan que haber vivido y muerto en el mismo periodo que cionismo como al evolucionismo, las fuentes de informacion humanos mas primitivos. Si este es el caso, no podrfan haber se siguen desarrollando, 10 que deja las interpretaciones abier- evolucionado en una epoca posterior. tas a revision a medida que se revelan nuevos datos. Cuando el relato del hallazgo de Reck se publico por pri- Las preguntas primordiales sobre la evolucion en 10 que mera vez, los escepticos de esa epoca sugirieron que los esque- concierne a los origenes humanos brotan de dos suposicio- letos modernos habian sido arrastrados 0 depositados en ese nes que son de importancia clave para la teorfa. Son las ideas estrato posteriormente. Aunque tales condiciones, si llegaran de que: a existir, ciertamente podrfan explicar el misterio, el descubri- miento de casos similares 16 siguiere que los hallazgos podrfan • la vida podrfa surgir de manera espontanea a partir estar mostrando algo mucho mas significativo. Agregan datos de material carente de vida, y a un creciente corpus de evidencia que sugiere que tal vez no somos el producto de una escala evolutiva clara, como la que • las caracterfsticas que nos hacen unicos son el resul- se ve en los pinzones de Darwin. Si en realidad, seres humanos tado de fuerzas evolutivas que actuan solas. modernos habitaron la Tierra simuldneamente con los que se han considerado sus ancestros primitivos, entonces debemos Aunque existe evidencia muy solida de que ciertos precur- plantear la siguiente pregunta: ~De donde vinieron? ~De don- I sores de la vida, como las nubes de amoniaco y los bloques de de vinimos? construccion de la clorofila en las plantas y de la hemoglobina en los animales (porfirina) existen en el espacio profundo, por 10 que se sabe, nunca se ha observado que la vida surja de Combinando [as teoTlas de nue.stros oTlgenes materiales carentes de'vida, en condiciones naturales 0 en con- La palabra "teoria" se define como una "suposicion disefiada diciones de laboratorio. Los evolucionistas abordan esta ironia para analizar 0 explicar la naturaleza de fenomenos espedfi- sugiriendo Slue, aunque no vemos la creacion espontanea de 42 El C6digo de Dios Huesos, libros y celulas 43 vida en la actualidad, las condiciones para ese tipo de proceso cos como documentos de sucesos tradicionales e historicos, pudieron estar presentes en cierta epoca en el pasado y luego estan fisicamente incompletos. Despues de que en el siglo IV haberse destruido debido al desarrollo de la vida en SL 17 se eliminaron al menos 45 libros del Antiguo y del Nuevo Incluso cuando las condiciones de temperatura, humedad Testamento por ordenes del Emperador Constantino, en el y elementos quimicos sean favorables para la vida esponranea, ano 345 de nuestra era,18 la version canonica del texto biblico parece haber una fuerza que supera las propiedades de la qufmi- a partir del cual el Obispo Ussher hizo sus dlculos tambien ca la cual infunde vida en los elementos de la creacion. AI estaba incompleta. parecer, esta fuerza no se explica en las teorias de la epoca de Aunque tanto la teoria del creacionismo como la de la evo- Darwin ni en la sabiduria convencional de nuestros dias. lucion ofrecen informacion util sobre la naturaleza de nues- Como se menciono antes, si las especies en realidad evolu- tros origenes, podrfamos descubrir que una combinacion de los cionan con caracteristicas geneticas nuevas, en lugar de adap- conceptos clave de ambas teorfas ofrece una mejor explicacion tarse a traves del tiempo, entonces una posibilidad que de las evidencias que se han observado hasta la fecha. Tal teorfa esperariamos ver en los fosiles es una progresion lineal de una hfbrida sobre la creaciOn toma en cuenta las observaciones de la forma de vida a la siguiente. En lugar de eso, el desarrollo que teoria evolutiva, que dicen que nuestro mundo es antiguo y muestran los registros en los fosiles sugieren que especies que an- que los procesos geologicos en efecto ocurren a 10 largo de tes se crda habian evolucionado de otras parecen haber convi- grandes periodos. Ademas, incorpora el punto de vista del crea- vido durante el mismo periodo, 10 que hace que su aparicion cionismo de que una fuerza especial, que supera 10 que la cien- como progresion lineal sea poco probable. cia convencional reconoce en la actualidad, es responsable de De manera similar, la teoria de la creacion ha estado reple- la chispa que vemos como "vida", y de poner en movimiento ta de preocupaciones relacionadas con la exactitud de los dlcu- las condiciones de las que ha surgido la vida. los del Obispo Ussher, de sus Fuentes y de la rigidez de sus Cuando no se cuenta con observacion directa, una teoria aseveraciones. Como en el caso de la teoria evolutiva, estas! es la mejor respuesta disponible para explicar cierto fenome- preocupaciones brotan de las suposiciones en que se basa la no. El hecho es que ningun ser que viva en la actualidad obser- teoria, 10 que incluye estas ideas: v6 directamente el momenta en que se inici6la creacion. Por el momento, una teoria combinada que incorpora elementos • los registros biblicos sobre la creacion son exactos, y tanto del creacionismo como de la teoria de la evoluci6n pare- • los registros biblicos sobre la creacion estan comple- ce ser nuestra mejor explicaci6n del misterio y milagro de la tos en 10 que se refiere a los relatos en sL vida. AI mismo tiempo que reconoce las evidencias fisicas que se han descubierto hasta la fecha, tambien permite el sentido Los mejores eruditos de nuestros tiempos estan de acuerdo intuitivo, que comparten la mayoria de los pueblos del mun- en que a pesar de los buenos que son nuestros registros bfbli- do, de que somos parte de algo mayor. 44 El C6digo de Dios Huesos, libros y celulas 45 Vida pOT designio conclusiones con respecto a que fuerza 0 fuerzas adicionales podrfa atribuirse la complejidad de la vida. En ellibro de texto universitario Chemistry, Matter, and the De manera similar, cuando se Ie pregunt6 a Francis Crick Universe [La qutmica, fa materia y el universoJ, la definici6~ de sobre la posibilidad de que la vida haya surgido de una serie de "vida" desde el punto de vista de la quimica es: "La vida es un sucesos al azar, el sefial6: "un hombre honesto, equipado con patr6n de comportamiento que los sistemas quimicos exhiben to~o el ~onocimiento disponible en este momento, s610 po- cuando alcanzan cierto tipo de nivel de complejidad".19 Aun- dr~a declf que hoy en dia, el origen de la vida parece casi un que esta definici6n podrfa, de hecho, describir un aspecto de mtlagro en cierto sentido, siendo tantas las condiciones que la exitencia, nos deja con una sensaci6n de vado; una sensa- tendrfan que haberse satisfecho para ponerla en marcha".21 ci6n de que falta algo. ~Somos simplemente el producto de Charles Darwin hizo sus observaciones en la decada de 1830. elementos quimicos que se combinan, evolucionan y cambian Despues de mas de cien afios, con el beneficio de los extraor- al azar a traves de los e6nes? ~O somos algo mas? ~Sera posible dinari~s avances de la ciencia y de los metodos experimenta- que en realidad seamos el resultado. de una 'serie de sucesos les, Cnck lleg6 a conclusiones similares. bien pensados y perfectamente cronometrados? ~De una ac- AIgunas de las mentes mas brillantes de nuestros tiempos ci6n de creaci6n intencional? sospechan ahora que ademas de un periodo muy largo y de Si como 10 sugieren las tradiciones mas antiguas de la huma- los procesos naturales que se reconocen, la vida parece haber nidad, la vida humana es el resultado de una acci6n muy anti- 'illfgido a partir de un designio. Este capitulo empez6 con la gua, realizada con un prop6sito, entonces tambien debemos ' pregunta: ~Quienes somos? Como especie, nuestra busqueda, plantear la siguiente pregunta: ~Quien 0 quejuerza es respon- Iratando de dar respuesta a esa pregunta, nos ha llevado a una sable de tal despliegue de poder, sabidurfa y visi6n? AI res- ' Iravesi~,de s~gl~s de misterio, derramamiento de sangre yex- ponder a esta pregunta tal vez podrfamos, por primera vez en p~oraclOn. Sm Importar que palabras utilicemos para descri- muchisimo tiempo, empezar a darle sentido a nuestro mundo Illmos en la actualidad, nuestra existencia es un misterio que y a encontrarle un mayor significado a nuestra vida. lontinua y se desenvuelve. En El origen de las especies, Darwin mismo mencion6 la Por el momento, podemos decir con certeza razonable que improbabilidad de que la selecci6n natural fuera el unico fac- somos ~as de 10 que nadie se ha atrevido a imaginar jamas, y tor responsable del grade de especializaci6n que vemos en los llue qUlzaS somos capaces de todo 10 que alguna vez hemos 6rganos y tejidos. Sefial6 como ejemplo la complejidad del ojo \ofiado. Incluso para el ciendfico mas esceptico, un creciente diciendo: "Suponer que el ojo, con todos sus mecanismos ini- lorp~S de evidencia sugiere que la fuerza de una inteligencia mitables para ajustar el foco a diferentes distancias... pudiera \upenor subyace nuestra existencia. Ademas del grado de or- haberse formado mediante selecci6n natural, pareceda absur- ' dt·n que existe como fundamento de toda vida, que en la ac- do en alto grado, y confieso esto libremente".2o Con esa obser- IIlalidad es obvio, el enfoque de este libro describira mas a vaci6n, Darwin nos da libertad para llegar a nuestras propias 'ondo un or,den de magnitud aun mayor: un lenguaje alfabeti- 46 El C6digo de Dios Huesos, libros y celulas 47 co codiftcado como los elementos de la vida en $1. Este orden En el mejor de los casos, el revelar que el nombre de Dios superior es 10 que sugiere la presencia de una inteligencia mas esta en el interior de toda vida proporcionaria nueva evidencia grande como fuente de nuestra existencia. de que estamos aqui con un proposito, compartiendo nuestro mundo como una familia. Ese principio podria ofrecer un tan IQue significarfa descubrir necesario criterio de esperanza, en una epoca en la que nues- un mensaje de "Dios"? tras diferencias a menudo se interpretan como la razon que nos separa, y no como la diversidad que nos fortalece. Un En la actualidad tenemos las poblaciones mas numerosas de mensaje descubierto en el interior de la quimica de cada cuer- nuestra historia, con ellas construimos naciones, educamos fa- po, sin importar la religion, el estilo de vida, la raza, 0 las creen- milias, formamos ejercitos y nos movemos a toda velocidad cias, seria una serral de naturaleza tan universal, que podria con la ciencia mas avanzada que se cree ha existido. Tomando trascender cualquier diferencia del pasado. en cuenta las diftcultades que enfrentamos al v.ivir en un mun- Estudios recientes sugieren que el impacto de un descubri- do como este, Nue signiftcaria encontrar un principio que to- miento de ese tipo podria ser similar al impacto que experi- cara la vida de cada ser humano en el mundo actual, un mensaje mentamos cuando recibimos una noticia que cambia nuestra uniftcador tan profundo, tan poderoso y tan personal que no vida en forma dramatica e inesperada. Tal vez asimilariamos pudiera negarse? Abriendonos camino entre las diferencias ex- esta noticia en etapas, de manera muy similar a la forma en ternas que nos dividen como familias, naciones y religiones, que asimilamos la perdida de un ser querido. En un sentido solo podemos imaginar 10 diferente que seria nuestra vida y la ' muy real, el conocimiento de que somos el resultado de una forma tan diferente en que construiriamos nuestro mundo, si creacion intencional nos invitaria a reemplazar nuestro siste- tuvieramos la certeza de que nuestra existencia brota de un ma actual de creencias por otro que incorporara el conoci- Creador cuyo nombre esta literalmente escrito en clave en el miento que acabamos de descubrir. De hecho, podriamos interior de cada celula de nuestro cuerpo. encontrar que lamentamos la perdida de nuestras antiguas Ese descubrimiento se convertiria, al menos, en el hito de creencias a medida que deftnimos nuestro papel en la crea- una nueva era que dejara en claro nuestra mutua relacion como cion. En este tipo de circunstancias, las etapas de una perdida: seres humanos y nuestra relacion con nuestro mundo. Aun- impacto, negacion, rechazo, enojo y ftnalmente aceptacion, que un mensaje de este tipo no podria identiftcar con preci- nos ofrecen un indicio de la profundidad con que este tipo de sion quien es el Dios de la creacion, la naturaleza universal del conocimiento tocaria nuestras vidas. antiguo nombre de Dios en el interior del codigo de la vida, EI asombroso descubrimiento que se presenta a continua- un nombre que la ciencia del siglo XX ya ha conftrmado, se cion describe precisa~ente un principio de unidad de este tipo: sumaria al creciente corpus de evidencias que sugieren que 10 el nombre antiguo de Dios, codificado en el elemento funda- que es responsable de nuestra creacion no se limita a una com- mental de nuestra existencia. Oculto en 10 profundo de nues- binacion forruita de sustancias qufmicas y a la evolucion. tro ser desde cI dra de nuestros orfgenes, cl codigo ha esperado 48 El C6digo de Dios Huesos, libros y celulas 49 el momenta en que nuestra busqueda nos lleve a yiajar a nues- nuestra relaci6n con un poder superior cuando nos tro interior, a la esencia de toda vida. Quizas no deberia sor- enfrentemos a opciones futuras en 10 social, 10 tec- prendernos descubrir que el secreta que compartimos con Dios no16gico y 10 cientifico. y con la vida da un nuevo significado a nuestro tiempo y a la • Descubrir "quienes" somos podria finalmente con- presencia de otros seres humanos como nosotros. tener la clave para la paz de nuestro mundo y para nuestra supervivencia. RESUMEN DEL CAPITULO 2 • Por si solas, las teorias de la evoluci6n y el creacionis- mo son inadecuadas para explicar los hechos que con- sideramos fueron nuestro pasado. En cada una de ellas parece faltar algo. • Las teorias hibridas de la cread6n, que combinan elementos de la evoluci6n y el creacionismo, sugie- ren que un factor adicional, una fuerza que aun no se ha explicado, pudo haber tenido un papel clave en el origen de la vida. • Las tradiciones de la antigiiedad sugieren que la cla- ve de los misterios mas profundos de la humanidad, y la clave para la paz y la supervivencia, podrian en- contrarse en el mayor logro de la creaci6n de Dios: la vida en s1. • Uno de los descubridores de la estructura del ADN sugiere que el hecho de que todos los factores estu- vieran en ellugar y el tiempo adecuados, y de que la vida surgiera por casualidad, es practicamente un milagro. • El descubrimiento de la quimica de la vida, el ADN, es un c6digo antiguo en un idioma universal que ofrece un principio sin precedente para la unidad de los hombres. Ante tal mensaje, debemos repensar Capitulo Tres DE LOS LIBRaS PERDIDOS DE LA CREACION: Los poderes del clelo en cuerpos de la Tierra S e cree que las estadisticas de poblaei6n de los censos del ano 2000 son las mas exactas de la historia, e indican que compartimos nuestro mundo con aproximadamente 6.2 bi- Ilones de seres humanos. De ese numero, casi el 95 por ciento, l'S decir 5.9 billones de personas, creen en la existeneia de un Ser Supremo de eierta descripci6n. Mas de la mitad de esas personas se refieren a el como "Dios". Estas y otras estadisticas \imilares indican que en nuestros dias la pregunta tal vez no \l'a si creemos 0 no que Dios existe, sino que es exactamente 10 que esta presencia significa en nuestra vida. C6mo encontrarle sentido a un poder superior Aunque durante mucho tiempo la espiritualidad ha tenido 1111 papel en la evoluci6n de las familias, las comunidades y El C6digo de Dios De los libros perdidos de la creaci6n 55 54 las naciones. Nuestro futuro podda no depender. de nuestra En respuesta, Ellie se pregunta en voz alta si nuestro sentido capacidad para reconocer que no somos simplemente una com- de Dios brota de una "necesidad" de afiadir significado a nues- binacion fortuita de moleculas al azar. Desde mediados del tra vida. Despues de un momenta de silencio, Palmer respon- siglo XX, el tema de nuestra busqueda de una inteligencia de con las mismas palabras que Ellie habla escuchado de su superior se ha expresado en el arte, la literatura y las peHculas padre siendo muy joven, muchos afios antes de la muerte de a nivel mundial. En 1998, la peHcula Contacto, que se basa su padre. Pareceria un desperdicio de espacio sijUiramos los unicos. en el libro de Carl Sagan del mismo nombre, presenta dos En muchos aspectos, la tension espiritual entre la Dra. perspectivas distintas de nuestra relacion con un poder supe- Arroway y Palmer Ross describe la polaridad de nuestros pun- rior, 10 cual refleja el dilema actual entre la ciencia y la re- tas de v~sta en la actualidad. Palmer ve su experiencia de un poder superior con los ojos de alguien entrenado en la reli- ligion. AI principio de la pelicula, la protagonista, la Dra. Ellie gion, que interpreta su sentimiento como la presencia de Arroway, se encuentra en la ubicacion. perfecta para dedicarse "Dios". La pasion de Ellie por la ciencia, estimulada por su a la pasion de su vida: la investigacion ciendfica que busca padre desde su infancia, f~rja su sentido de una inteligencia inteligencia mas alIa de la Tierra. Sentada en el borde del ra- superior como una probabilidad estadlstica de que exista vida dio-telescopio mas grande del mundo, el Aricebo que se loca- en otros mundos. Ambos puntos de vista reconocen la sensa- liza en las montafias de Puerto Rico, ella Ie describe al teologo cion de una presencia universal, una fuerza que la ciencia aun y escritar Palmer Ross las posibilidades de que exista vida inte- no ha definido. Ambos des<;:ubren que, en el mejor de los c~­ ligente en otros sitios del universo. Ella comenta que unica- 50S, una prueba absoluta de tal presencia es esquiva y que fi- mente en esta galaxia hay mas de 400 billones de estrellas. Si nalmente debe experimentarse para comprenderse. La solo una fraccion de ellas tuvieran planetas, una fraccion de revelacion de Ellie es el resultado de su odisea al ser transpor- esos planetas tuvieran vida, y una fraccion de los planetas don- tada en el espacio tiempo, regresando sin una evidencia de su de hay vida tuviera vida inteligente, jexistidan millones de ci- experiencia con otros seres que pueda compartir. La revelacion de Palmer brota de su fe como una fuerza que no puede mos- vilizaciones! Contemplando el cielo nocturno, y luego midndose a los trarle a nadie mas, y que el nunca ha vista. ojos, desde perspectivas muy distintas, ambos sienten que no Aunque 10 mas probable es que exista una inteligencia su- estamos solos. Desde la perspectiva de Palmer, la creencia en perior en el universo, por el momenta parecemos estar solos. un poder superior, compartida por muchos, es nuestra expe- Es en nuestra sensacion de "soledad", a pesar de que ahora riencia colectiva de la presencia de Dios. Mas tarde, en un (enemos la poblacion mas grande de la historia del mundo, momenta de conversacion Intima, el confiesa que su creencia que la ironIa de no saber quienes somos adquiere un significa- en ese poder es algo que supera su capacidad de explicarlo in- do aun mayor. Aunque la ciencia entra valientemente al siglo telectualmente. Simplemente "existe". XXI, en un nivel intimo todavia necesitamos entender con precision como lIegamos a existir. 56 E1 C6digo de Dios De los libros perdidos de 1a creaci6n 57 Claves antiguas sobre ell/principio" la antigiiedad describieron las visiones y revelaciones que les A pesar de 10 buena que parece ser nuestra ciencia, las mentes ayudaron a encontrarle sentido a su vida. En ese vocabulario mas privilegiadas de nuestros d{as admiten que nuestra com- por ejemplo, las "dimensiones" se describen como "cielos'" prension actual es incompleta. A pesar de la daridad del codi- mientras que las fuerzas de la naturaleza se transforman e~ go genetico, las ecuaciones de Einstein sobre la energ{a y la "~ngeles" de.l Sol, del Viento, de la Tierra y del Aire; y la capa- materia, la maravilla de la comunicacion por Internet, existen Cldad conSClente del individuo se capta como "el aliento de huecos que siguen sin llenarse en nuestra vision ciendfica de la Dios". creacion. Citando una observacion comun: Cuanto mas des- A 10 largo de la historia han existido rumores sobre conoci- cubrimos, mas comprendemos 10 poco que sabemos. mie~tos.que preservan tales experiencias visionarias, cuya Fuente AI mismo tiempo, es posible que la respuesta a nuestra se dice data de la epoca de nuestros inicios. Mediante el estu- pregunta sobre "como empezo todo" ya exista de una manera! dio de nuestras antiguas leyendas, es comun descubrir un fun- que ha sobrevivido a las pruebas del hombr~ y la naturaleza. damento basado en hechos a partir del cual se crearon esos Encerrados en vasijas de barro y enterrados bajo siglos de are- re~atos y mitos, algunos de los cuales han persistido durante nas del desierto, los codigos escritos de nuestro pasado po- mIles de afios. drian tener tambien los registros mas completos sobre nuestros ~l descubrimiento de la ciudad de Troya por Heinrich origenes. Ademas, podriamos descubrir que los rastros de le- Schhemann en 1870, por ejemplo, se baso en su creencia de tras escritas y los pergaminos a punto de desmoronarse que que La Iliada, la obra clasica de Homero, era un relato real preservan nuestra historia, tambien contengan el secreta de de h~chos historicos. Utilizando La Iliada como mapa verbal, nuestras capacidades y nuestro destino. As! como los poblado- Schhemann siguio las pistas del texto y logro uno de los ha- res de Norteamerica describieron su experiencia inicial con el I llazgos arqueologicos mas grandes del siglo XIX. Otros ejem- ferrocarril diciendo que era un "caballo de hierro", la clave es pios de descubrimientos que fueron el resultado directo del reconocer que los secretos de nuestro pasado se han registrado estudio e i~v~stigacion de leyendas y mitos antiguos, induyen como los pensamientos y las ideas de otras epocas. e1 descubnmlento de Machu Pichu, la Ciudad Perdida de los En el vocabulario de su tiempo, nuestros ancestros descri- Incas, por Hiram Bingham en 1911, Y el descubrimiento bieron como recibieron respuestas a las mismas preguntas que ~el Area de Noe en el Monte Ararat en Turqu{a a finales del nosotros nos hacemos hoy en db, cuestionando nuestro ori- slglo XX. gen, el significado de la vida y como sobrevivir a los sufrimien- tos del mundo. Antes de que se popularizara el vocabulario El Lihro de Aa'J'n que se habra perdido: para describir otras dimensiones y los hologramas cuanticos t Sabidurfa de ange.les en el mundo del hombre los principios para explicar los misterios de la creacion ya exis- Como en e1 caso de la ciudad de Troya, los persistentes rumo- dan. Con las unicas palabras que ellos sabfan, los eruditos de res sobre un antiguo Iibro de sabidur{a presentado a Adan y 58 El C6digo de Dios De los libros perdidos de la creaci6n 59 Eva cuando estuvieron en el Jardin del Eden, indica que esta y guiado a una cueva en Tierra Santa donde estaban sepulta- leyenda podria en realidad basarse en un suceso hist6rico. Sin dos muchos patriarcas y matriarcas de la antigiiedad. En esta embargo, el misterio de esta leyenda nunca se ha resuelto. Se cueva encontr6 el unico ejemplar del Libro de Addn. dice que s610 ha existido un ejemplar de este libro, que sus El Rabino Ie pidi6 a su hijo que localizara al joven Israel letras estaban impregnadas de una sustancia misteriosa que ben Eliezer y Ie entregara ellibro personalmente. La leyenda evitaba que las paginas se copiaran 0 se reprodujeran. A traves continua con la descripci6n de c6mo el hijo del Rabino de la forma, los tonos y las cualidades del texto, los secretos de encontr6 a Israel que vivia en un granero, donde se desvelaba la creaci6n y de los origenes de la humanidad estaban ocultos leyendo las palabras de la Torah, la Sagrada Escritura de los en las propias letras. Para proteger el contenido del libro y judios.. evitar que se Ie diera mal uso, s610 podian entenderlo quienes Una noche, al investigar la Fuente de un resplandor que tenian una madurez espiritual que les permitiera encontrar venia de atras de la puerta, el hijo del Rabino fue testigo de sentido a sus simbolos. Dice la leyel'l:da que para todos los de- un milagro que Ie corrobor6 que Israel era en realidad digno mas poseer este libro careda de significado, y cualquier inten- de recibir ellibro de los secretos. AI mirar por la ventana, pre- to de hacer mal uso de su contenido acarreaba la desgracia a ocupado por la posibilidad de que la intensidad de la luz se sus vidas. debiera a que de una vela hubiera incendiado la paja del gra- Aunque los detalles del libro conocido como Libro de nero, s610 vio un resplandor que emanaba del cuerpo del pro- Addn se han desvanecido al paso del tiempo, los rumores de su pia Israel. El resplandor no era producto de un incendio, sino existencia persistieron hasta el siglo XVIII. Se dice que en esa de la inspiraci6n que Israel recibia alleer las palabras de la epoca, ellibro lleg6 a manos de Israel ben Eliezer, que mas Torah. tarde fue conocido como el padre del Judaismo Chassidut. AI dia siguiente, el hijo del Rabino cumpli6 el ultimo de- Hasta entonces, el Libro de Addn s610 habia sido propiedad ' seo de su padre y entreg6 a Israel este libro mistico. Gracias a de seis individuos: Adan, Jose, Moises, Josue ben Nun y Sa- sus enseiianzas, tomadas del Libro de Addn, Israel ben Eliezer lom6n.! fue conocido como Baal Shem Tov, es decir: Maestro del Santo La leyenda cuenta que en una poblaci6n cercana a donde Nombre. Esta fue la ultima ocasi6n en que se mencion6 el Li- estaba Israel ben Eliezar, vivia un rabino que, aunque no tenia bro de Addn en la literatura abierta. ellibro, sabia de su existencia. AI sentir que se acercaba el fin de sus dias, el Rabino Adam Tzaddik utiliz6 una "pregunta en Los libros perdidos de la Biblia sueiios" para pedir que se Ie guiara y asi poder realizar este acto final de bondad antes de dejar este mundo. Su pregunta, ex- El siglo :xx fue testigo del hallazgo de algunos de los registros presada con sencillez, era: ~a quien deberia entregar el Libro de \ mas significativos e intrigantes de la historia humana. Entre Addn antes de su muerte para garantizar que la verdad del hom- ellos, los pergaminos del Mar Muerro, que contienen textos bre continuara? Mas tarde esa noche, fue despenaclo de su suefio b!blicos perdidos y la traducci6n de miles de tablas sumerias, De los libros perdidos de la creaci6n 61 60 El C6digo de Dios de textos gn6sticos y del Nuevo Testamento que .eran parte de de Enoch. Como resultado de sus esfuerzos, el Concilio reco- la Biblioteca Nag Hammadi en Egipto. Existe cada vez mayor mend6 que se retiraran al menos 45 documentos. El resultado evidencia de que la cadena de conocimiento que une la sabi- \igue con nosotros hoy en dia, y representa uno de los libros duria antigua con nuestro mundo moderno en realidad se ha mas poderosos y controvertidos de la historia de nuestro mun- interrumpido en mas de una ocasi6n. Cada vez que los textos do, la Santa Biblia. de nuestro pasado se han eliminado, escondido 0 redactado de A partir de las cartas que nos dejaron los miembros del otra manera, el misterio de nuestra identidad se ha confundi- Concilio de Nicea, es claro que las ediciones originales se hi- ' mas. do aun , cieron con buena intenci6n. Por ejemplo cuando se Ie pre- Como gran parte de la manera en que vemos nuestro pre- gunt6 a Wake, Arzobispo de Canterbury, por que eligi6 traducir sente se basa en una comprensi6n incompleta de nuestro pa- y publicar esos textos antiguos en lugar de sus obras contem- sado, no deberia sorprendernos que muchos de nuestros pocaneas, el respondi6: "Porque tenia la esperanza de que es- principios cientificos, de nuestras practicas moo.icas, ideas reli- toS escritos tendrian una aceptaci6n mas general y con menos giosas y hechos hist6ricos, al igual q·ue la forma en que nos prejuicios entre todo tipo de personas, que algo que pudiera servimos de ellos, tambien esten incompletos. Quiza una de l'scribir una persona que aun viviera".3 ~C6mo podrian saber las mayores interrupciones en nuestra cadena de conocimien- los miembros del Concilio de Nicea que ellibro que produ- to fue resultado de la edici6n de la Biblia realizada por la Igle- cirian llegaria a ser el fundamento de una de las religiones sia Cristiana en el siglo IV mas importantes del mundo y que mas de la tercera parte de Los eruditos reconocen abiertamente las ediciones de los la poblaci6n mundialllegada a considerarlo ellibro mas sa- textos cristianos antiguos yel hecho de que se haya eliminado grado? material de ellos, a manos de un grupo que se reuni6 para es- En afios recientes, se han recuperado muchos de los libros tablecer la doctrina de la Iglesia en el afio 325 de nuestra era. 2 que se eliminaron en las ediciones del siglo IV, se han tra- Bajo la direcci6n del Emperador Romano, Constantino, los ducido y se han puesto a disposici6n del publico en general. obispos, el clero y los historiadores que formaron parte del Por 10 que yo se, no existe una compilaci6n que contenga to- Concilio de Nicea, se enfrentaron a la tarea de transformar dos los textos en su orden original, pues las traducciones son el siglos de obras religiosas dispersas en un solo documento que resultado del trabajo de diferentes interpretes que trabajaron tuviera sentido para la gente de esa epoca. Tomando en consi- can diferentes idiomas a 10 largo de los siglos. Existen, sin deraci6n la colecci6n indefinida de parabolas, ensefianzas y embargo, grupos de traducciones que han estado disponi- registros hist6ricos, muchos de los libros que les fueron pre- bles de vez en cuando, como una compilaci6n de libros perdi- 4 sentados eran redundantes yestaban mal escritos, con versiones dos de la Biblia que se public6 a principios del siglo XX. A superpuestas y relatos repetidos. En algunos casos, el Concilio continuaci6n se pre~enta una lista parcial de los libros que encontr6 que los textos eran tan misticos, que sus miembros sabemos fueron eliminados en las ediciones del Concilio de creyeron que no ten{an valor prcktico. Ese fue eI caso del Libro Nicea. 62 El C6digo de Dios De los libros perdidos de la creaci6n 63 Cartas de Herodes y Pilatos Ilnfancia Mar Muerto: Los pergaminos del Mar Muerto. Este hallazgo Tralianos II Infancia es fuente de muchas controversias, pues varios de los docu- Romanos Efesios mentos que se descubrieron en las cuevas se reconocen en la Policarpo I de Hermas; Visiones actualidad como libros que se "perdieron" durante las edicio- Filadelfia II de Hermas; 6rdenes nes del siglo IV. Aunque segun algunos eruditos todavia se Pablo y Tecla III de Hermas; Similitudes podrian encontrar mas pergaminos, la biblioteca de documen- Pablo y Seneca El Credo de los Ap6stoles tos que se tom6 de once cuevas cercanas al Mar Muerto cons- Nicodemo I de Clemente tituye el tesoro mas significativo de textos biblicos que se ha Magnesianos II de Clemente descubierto hasta la fecha, Maria Bernabe Entre 1946 y 1956, se reconstruyeron mas de 22,000 frag- mentos de manuscritos en pergamino, cobre y papiro, 10 que Aunque muchos de los libros de la lista, anterior fueron representa 900 rollos que revelan la versi6n original de libros relegados a la oscuridad despues de haber sido retirados, algu- del Antiguo Testamento como el Genesis, Isaias, y las pala- nos otros no 10 fueron. Los siguientes libros se consideran se- bras de Moises. Hershel Shanks, editor de la revista pionera cundarios, 0 documentos de apoyo. Esta es una lista parcial de Biblical Archeological Review [Publicacion Bfblica ArqueolOgi- textos que normalmente se reservan para los eruditos. cal coment6 la importancia de este hallazgo, diciendo: "Mas de 200 manuscritos biblicos estaban ocultos en las cuevas de El primer libro de Adan y Eva Sime6n Qumram, algunos dramaticamente diferentes a los textos que El segundo libro de Adan y Eva Levi encontramos en 1alIaB'bl'" .5 El Libro de Enoch luda La recuperaci6n, traducci6n, compilaci6n y publicaci6n Los Salmos de Salom6n Isacar de los manuscritos ha sido terna de grandes controversias desde Las Odas de Salom6n Zebulum el momenta en que se descubrieron. Incluso en la ultima EI Cuarto Libro de los Macabeos Dan decada del siglo XX, el acceso a la Biblioteca del Mar Muerto La Historia de Ahikar Neftali se limitaba a un equipo de s610 ocho eruditos. Como resul- El Testamento de Ruben Gad tado de presiones politicas y academicas, el contenido de los Asher Benjamin pergaminos se dio a conocer al publico en la decada de 1990. En 1991, la Biblioteca Huntington del sur de California re- Fragmentos de una Sabidurfa Superior cibi6 un juego completo de fotografias de los manuscritos y anunci6 que se darian a conocer al publico. A su vez, en no- Podrfa decirse que uno de ios hallazgos arqueol6gicos mas sig- viembre del mismo ano, Emanual Tov, jefe del equipo oficial nificativos del ultimo siglo fue el descubrimiento de una anti- de los manuscritos, proclam6: "se dara acceso libre e incondi- gua biblioteca oculta en unas cuevas cercanas a la costa del donal a t~das las fotograffas de los Manuscritos del Mar Muer- 64 El C6digo de Dios De los libros perdidos de la creaci6n 65 to, inc1uyendo manuscritos que nunca antes se habian dado a conocer".6 Dos afios antes del descubrimiento de los Manuscritos del Mar Muerto, se encontro otra biblioteca de la sabiduria de la antigiiedad, una biblioteca que y~ ha empezado a cambiar nues- tra manera de pensar sobre el cristianismo prirnitivo. En di- ciembre de 1945, dos he~manos encontraron una coleccion de manuscritos enterrados en una vasija cerca de la aldea de Nag Hammadi, Egipto, cerca del rio Nilo. Antes de que las autoridades en el Cairo se dieran cuenta de ello, esta colec- cion, que consta de 12 manuscritos completos y ocho paginas de un decimo tercer documento, pasa~on por muchas manos. Ahora se conservan en el Museo Coptico del Cairo, y nadie esta seguro de cuantos otros manuscritos fueron destruidos al Figura 3.1: Dos paginas del texto gn6stico "perdido" del Evangelio de Tomas. El manuscrito esta escrito en griego y es uno de los textos que se utilizarse para encender hogueras y otros usos similares, antes descubrieron en la Biblioteca de Hag Hammadi, Egipto. [Fotograffa to- de que el hallazgo se autentificara y se registrara en el museD el mada por Melissa E. Sherman a traves del cristal.] 4 de octubre de 1946. No obstante, los manuscritos que se conservan, conocidos como la Biblioteca de Nag Hammadi, estan muy bien preservados y ofrecen datos pristinos y en oca- macion, habian caido en el olvido principios universales que siones sorprendentes sobre las tradiciones gnosticas y cristia- an sentido a nuestro mundo moderno. nas de la antigiiedad.7 Cuando se les considera en conjunto, es posible que estas De los angeles del delo: dos bibliotecas ofrezcan la vision mas completa del mundo lnstrumentos de muerte y e[ origen de [a guerra antiguo y de las tradiciones del cristianismo primitivo que se han tenido hasta la fecha. Las revelaciones de esta sabiduria han "ntre los documentos mas importantes y misteriosos que se sido de gran utilidad para llenar huecos y dar sentido a puntos h n recuperado en los Ultimos 200 mos, esta el Libro de Enoch, no coherentes en la escritura tradicional. AI tener la historia 1 se habia perdido. Es obvio que los primeros historiadores mas completa, se nos da nueva informacion sobre el misterio I la Iglesia Catolica sendan un gran aprecio por el Libro de relacionado con algunas de nuestras creencias mas apreciadas. {/loch, pues eso se ~enciona en comentarios cristianos escri- Aunque esta breve explicacion no les hace justicia a estos tex- or eruditos respetados como Ireneo, Clemente de AIejan- tos en su totalidad, se mencionan para ilustrar el hecho de que I y I o. Por ejemplo, en el segundo siglo de nuestra era, .I p rd r to do urn nt • y ) i n simi) r I infl r- I hi. t Ii l! r nu)i n drib Ilu ar linic d In h n 66 El C6digo de Dios De los libros perdidos de la creaci6n 67 'Ia literatura sagrada, y reconoce que aunque las. palabras de poderes con prudencia. Los seres humanos caredan de la ma- este profeta del Antiguo Testamento no se aceptaron en el ca- durez para aplicar el conocimiento con responsabilidad, y se Ie non hebreo, son de inspiraci6n divina y se les debe dar la mis- da a conocer a Enoch c6mo se Ie revelaron al hombre los secre- rna credibilidad que a otros documentos de la escritura, como tos de las plantas y las hierbas, dellenguaje, de la escritura y de los Libros de Isaias y el de los Salmos. 8 De manera espedfica, la alquimia, y que el hombre posteriormente hizo mal uso Tertuliano afirma: "Como Enoch ha hablado en la misma es- de ellos enfocandolos a la guerra y al poder. En respuesta a su critura en que habl6 el Sefior, y 'toda la escritura que pueda petici6n de que se Ie mostrara "todo 10 que esra oculto", se Ie edificamos es de inspiraci6n divina', no rechazaremos nada de permite a Enoch conocer los nombres de los "angeles que han 10 que nos pertenece".9 descendido del cielo a la Tierra, y han revelado los secretos a La primera menci6n del texto de Enoch en tiempos mo- los hijos de los hombres y los han seducido para que cometan demos, despues de haber estado perdido durante casi 1500 el pecado". 12 afios, fue cuando James Bruce 10 descubri6 en 1773. Bruce, Enoch menciona angeles espedficos y los secretos que di- un explorador escoces, mencion6: "Entre los objetos que en- vulgaron, y describe como el angel Azazyel "ensefi6 todo tipo tregue a la biblioteca en Paris, estaba un ejemplar magnifico de iniquidad sobre la tierra, y dio a conocer al mundo todas las de las profedas de Enoch". 10 Se entreg6 una copia de este ma- cosas secretas que se hacen en los cielos". 13 Continua diciendo nuscrito a la Bodleian Library de Oxford, donde fue re-descu- que el angel Gadrel "revel6 a los hijos de los hombres los ins- bierta y traducida por Richard Lawrence en 1821. trumentos de la muerte, la cota de malla, el escudo y la espada EI Libro de Enoch empieza con un relato en el que el profe- para la matanza".14 ta dicta la historia oculta de la raza humana a su hijo Matusa- Ademas de estas revelaciones perturbadoras, a Enoch se Ie len, tal como Ie fue revelada por el angel de la paz. Matusalen mostr6 la Fuente de la belleza de los misterios de la creaci6n. escribe que las palabras de su padre se pronunciaron mientras "Ahi tambien, mis ojos contemplaron los secretos del relam- Enoch contemplaba una "visi6n en los cielos ... con los ojos pago y el trueno... ahi percibi ellugar de donde salen, y me completamente abiertos". II En un estado de alerta, aunque sature del polvo de la Tierra... Ahi vi la nube que permaneci6 alterado, Enoch describe las razones del deterioro de la huma- sobre la Tierra antes de la creaci6n del mundo". 15 nidad y la Fuente de sus sufrimientos, queel y Matusalen con- Haciendo una distinci6n entre el conocimiento y la sabi- templaron en su tiempo. Aparte de las referencias vagas y duria que se produce al aplicar el conocimiento en nuestra generales que al parecer siempre acompafian a las visiones de vida, Enoch describe c6mo los secretos del cielo final mente los antiguos profetas, Enoch habla con claridad de su expe- se perdieron en el dominio del hombre. "La sabiduria fue a riencia con una extrafia precisi6n. vivir entre los hijos de los hombres, pero no consigui6 una De manera espedfica, Enoch describe como ciertos ange- lllorada". Enoch termina esta porci6n de su visi6n diciendo: les divulgaron los secretos de la creaci6n ala humanidad antes "La sabiduria no encontr6 un lugar en la tierra donde pudiera de que nuestra especie alcanzara la sabidurla para usar tales vivir; por 10 tanto, su morada esd en eI cielo".16 68 El C6digo de Dios De los libros perdidos de la creaci6n 69 Los poderes del delo en cuerpos de la Tierra claro en sus traducciones: Nuestros ancestros vieron nuestra relacion con Dios, con el cosmos y entre nosotros mismos de El descubrimiento y traduccion de textos adicionales sugiere forma muy distinta a la que prevalece hoy en dia en el mundo. que incluso antes de que el conocimiento del cielo se com- Sus escritos no nos hacen dudar de la magnitud del papel que partiera con la Tierra, los angeles de los cielos cuestionaron el elIos cretan que tiene Dios en nuestro mundo y en nuestra hecho de que la humanidad estllviera lista para recibir ese tipo vida. Aunque el descubrimiento que se describe en detalle en de informacion. Al combinar las cualidades de los angeles y este libro no logra definir con precision quien 0 que es Dios, un cuerpo material, a la raza humana ya se Ie habia otorgado describe las evidencias modernas de una inteligencia eterna una categoria sin precedente a los ojos de los angeles de Dios. que subyace nuestra existencia. Por ejemplo, el comentario del Libro de Haggadah de la tradi- Gracias allegado de enormes templos, piramides misterio- cion hebrea, describe como el hombre "reune en si cualidades sas, extensas bibliotecas y textos misticos, los miembros de las del cielo y de la Tierra". 17 Ademas el texto revela la razon que sociedades de la antigiiedad dedicaban su vida a preservar y tllVO Dios para crear nuestra especie, diciendo "Yo [Dios] crean~ comunicar los secretos de la creacion; secretos que ya eran an- al hombre para que sea la union de ambos, de modo que cuando tiguos en epocas remotas. En esos secretos habia un conoci- peque, cuando se comporte como una bestia, Ie sobrevenga la miento tan universal, pero tan sutil, que incluso hoy en dia la muerte; pero si evita el pecado, vivid por siempre" .18 mejor ciencia de nuestros tiempos ha tenido que esforzarse Segun textos gnosticos y textos que no son parte de los para captar su significado y sus implicaciones. _ canones, el hecho de otorgar al hombre aun mas secretos del cielo, fue un tema de gran controversia en el consejo de Dios El misterioso Sepher Yetzirah: en el cielo. El texto de Haggadah continua: "No todos los an- El Libro de la Creaci6n geles tenian la misma opinion", 19 10 que describe como los angeles de la verdad y de la paz se oponian ala creacion del Al parecer, algunos de los registros mas completos y detallados hombre, mientras que los angeles del amor y la justicia esta- sobre nuestros origenes se preservaron en ellenguaje y las tra- ban a favor del plan de Dios. Algo que les preocupaba espe- , diciones de los antiguos hebreos. Cuentan con una historia cialmente, eran las implicaciones y consecuencias de otorgar cuyo origen puede rastrearse hasta de mas de 5000 ailos, y aun poder a una sola especie al revelarle los secretos combinados podemos leer las palabras escritas por los eruditos hebreos tal del cielo y la Tierra, antes de que hubiera alcanzado la sabidu- como enos las escribieron hace cinco milenios. En esas palabras, ria para aplicar tales conocimientos con responsabilidad. se nos entrega una comprension profunda de la creacion del Libros como el Haggadah, representan solo una muestra universo, la formacion de la Tierra y finalmente, el origen de de un tema que esta presente en todos los relatos antiguos de nuestros cuerpos. Tal.vez la Fuente mas difundida del conoci- la creacion. Ademas, las investigaciones mas antiguas sobre miento hebreo es una coleccion de escritos misticos conocidos nuestro pasado colectivo revelan un punto de vista que es muy colectivamente como la Cabala. 70 El C6digo de Dios De los libros perdidos de la creaci6n 71 Aunque se Ie da un solo nombre, la Cabala ~s en realidad las obras de Dios paso a paso. El primer capitulo empieza afir- una coleccion de obras, y el origen de algunas de ellas se per- mando que nuestro mundo es el resultado de tres tipos de dio desde la antigiiedad. Estas obras conforman la tradicion informacion, registrada en tres tomos distintos: texto (Sepher), esoterica hebrea. En general, se cree que las obras mas impor- mimero (Sephar) y comunicacion (Sippur). A partir de estos tantes de la Cabala son el Zohar (Libro del Resplandor), el tres libros, el texto continua: "£1 [Dios] creo Su Universo".21 Midrash (Libro de la Iluminacion), y el Sepher Yetzirah (Libro A traves del Sepher Yetzirah, la narracion describe el acto de la Formacion). Cada uno de ellos contribuye a la compren- creador de Dios con niveles de detalle progresivamente mayo- sion general de Dios, de la humanidad y de la creacion en res en cada capitulo. Desde la formacion de los primeros ele- formas distintas pero complementarias. mentos del universo, representados como las letras hebreas del Los historiadores por 10 general reconocen que el Sepher antiguo nombre de Dios, hasta la manera en que el resto de las Yetzirah es el aspecto mas antiguo y quizas el mas misterioso letras del alfabeto hebreo dieron forma a "todo 10 que alguna r vez se lOrmo, ,,, 22 el ' umverso se desenvue1ve ante nuestros OJos . de estas obras. Aunque se desconoce su origep exacto, los eru- ditos hebreos tradicionales creen que el texto fue recibido di- como combinaciones precisas de estos elementos y letras. Con rectamente por el patriarca Abraham. De ser asi, las primeras un nivel de detalle sin paralelo en otros relatos de la creacion, versiones del Sepher Yetzirah tenddan una antigtiedad de 3800 el Sepher Yetzirah ofrece instrucciones precisas sobre la forma anos, 10 cuallas hace contemporcineas a algunos de los textos en que las 22 letras interaccionan entre si para crear la "mate- misticos mas antiguos de otras tradiciones, como el Veda de la I ria" con que esta hecho nuestro mundo. antigua India. Cuando se toman en cuenta todas las combinaciones de Los principios que contiene el Sepher Yetzirah pudieron ha- letras y se arreglan grcificamente formando un drculo, hay 231 ber llegado a nosotros a partir de tradiciones antiquisimas (aun- Hneas que conectan las posibilidades. El Sepher Yetzirah iden- que no existe evidencia directa que apoye esta afirmacion), tifica estas Hneas como 231 "puertas". Como veremos en el pero se cree que ellibro en si se origino durante el primer siglo capitulo 6, en una de estas puertas se nos entregan conoci- de nuestra era. Es en este periodo cuando el nombre de este mientos profundos sobre el mensaje de nuestras celulas. libro se menciona par primera vez. Una de las menciones mas Una de las numerosas formas en que se puede interpretar antiguas se atribuye al rabino Yehoshua, del primer siglo, quien ' la sabiduda de la C.ibala, es clasificar sus obras de acuerdo al declaro: "Puedo tomar calabacitas y calabazas y con el Sepher , enfoque que asumen al relatar sus secretos: teorico, magico y . Yetzuah, r translOrmar 1as en hermosos ar ' b0 1es,,20 . meditativo. Por 10 general, el Sepher Yetzirah se considera si- Con detalles sin paralelo, este conciso texto de solo unas multcineamente como un texto que pertenece a dos de estas 1500 Hneas, ofrece una vivida descripcion de los sucesos que categorias. En primer lugar se Ie considera un texto meditati- llevan al nacimiento del cosmos y 10 incluyen, y finalmente al YO, que lleva allectof a los secretos mas profundos de los rei- origen de nuestro cuerpo. Todo el texto estci escrito desde la nos espirituales mediante la contemplaci6n. Ademas, dene perspectiva de lIn observador antiguo que narra d milagro de fuertes Ylnculos con 10 que en ocasiones se denomina "magia" 72 E1 C6digo de Dios De los libros perdidos de 1a creaci6n 73 antigua, y Ie revela a quien la practica las instruc;ciones y tec- rah es en realidad un relato muy antiguo y muy rico del acto nicas para llevar la sabiduda de sus meditaciones al mundo intencional de la creacion. jEl proceso gradual, paso a paso, es fisico. un paralelo muy cercano a los descubrimientos de la ciencia En su aclamada traduccion del Sepher Yetzirah, el fallecido del siglo XX! rabino Aryeh Kaplan expresa con claridad esta vision dicien- La controversia y el misterio que rodea a los odgenes, la do: "Esta posicion [de que el Sepher Yetzirah es un texto me- precision y las interpretaciones del Sepher Yetzirah siguen sien- ditativo con fuertes visos de magia] cuenta con el apoyo de las do Fuente de acalorados debates en la actualidad. Existen al tradiciones talmudicas mas antiguas, que indican que podia menos cuatro versiones principales del texto y un numero casi utilizarse para crear seres vivos" .23 Se deda que la creacion y incalCulable de versiones menores, si se toman en cuenta todas destruccion de tales seres, llamados golem, demostraba los ni- las variaciones que han surgido a 10 largo de los siglos. Toman- veles mas altos de destreza en los misterios hebreos. Aunque do en cuenta la Version Corta, que tiene unas 1300 palabras, y en la actualidad existen fragmentos de estos, textos, quienes tambien la Version Larga, de 2500 palabras, el Rabino Kaplan estudian y practican este aspecto de fa Cabala consideran que sugiere que la razon de tantas variaciones es el secreta que se sus secretos son tan poderosos que los textos nunca se han requiere para preservar las ensenanzas. Los eruditos reconocen publicado en su totalidad. que entre los siglos VI y X, se hizo un intento por limitar el Ademas de preservar las mas antiguas y misteriosas obras poder del Sepher Yetzirah a un pequeno drculo de estudiosos. de la Cabala, el Sepher Yetzirah es sin duda e1 texto que mas "Los lideres de estas escuelas poddan haber publicado versio- controversias ha suscitado. La vision popular de esta obra es- nes falsas deliberadamente", dice el rabino, "para confundir a crita en prosa es que, aunque es interesante, es ante todo una . qUlenes se veian tentados a penetrar en sus mlstenos . . " .25 metafora de los misterios de la creacion. Quiza quien mejor Segun el Rabino Kaplan, los propios cabalistas fueron quie- resume este punto de vista tradicional es Karen Armstrong, nes finalmente produjeron un compuesto de las muchas ver- una erudita que es una autoridad en el mundo de las religio- siones que concordara con las ensenanzas mas antiguas. Esta nes. En su novedoso y muy aclamado libro, A History ofGod version se creo originalmente en el siglo XVI y se refino aun [Una historia de Dios}, afirma que en el Sepher Yetzirah "no se mas en el siglo XVIII, como la Version Gra (llamada asi por el intenta describir el proceso de la creacion en forma realista; el Gra Rabi Eliahu), que es la base del esfuerzo monumental que relato es atrevidamente simbolico y muestra aDios creando culmino en su libro, Sepher Yetzirah: The Book of Creation 26 el mundo a traves dellenguaje , como si estuviera escribiendo [Sepher Yetzirah: Libro de fa creacion}. Esta es la version a la que un l1'b ro"24 . vamos a referirnos a 10 largo de este libro. No obstante, un examen mas detallado de este texto misti- El descubrimiento de un vinculo directo entre los elementos co sugiere que nos ofrece mucho mas que un relato de simbo- responsables de la vida y los idiomas hebreo y arabe de la anti- los y metaforas. Los descubrimientos que vinculan el alfabeto gliedad (ver el Capitulo 5) da un nuevo significado a las tra- hebreo con elementos modernos indican que el Sepher Yetzi- diciones religiosas y espirituales mas profundas de mas de la 74 El C6digo de Dios De los libros perdidos de la creaci6n 75 mitad de los habitantes del mundo. La historia que comparten nuestra comprensi6n actual es incompleta. A pesar las tradiciones judias, cristianas e isIamicas, reconocida por de la daridad del c6digo genetico, las ecuaciones de eruditos biblicos a traves del patriarca Abraham, sugiere que Einstein sobre la energia y la materia, y la maravilla el Dios de cada una de estas tradiciones es exactamente el mis- de la comunicaci6n por Internet, existen grandes la- mo Dios. Aunque su nombre varia de una tradici6n a otra, gunas en nuestra visi6n cientifica de la creaci6n. cada religi6n describe nuestro universo como el acto volunta- i •. Aunque reconocemos los grandes esfuerzos de la cien- rio e intencional de ese Dios. Desde esta perspectiva, este anti- ; cia para explicar la vida, la creaci6n y el universo, las guo relato podria verse como una descripci6n precisa de la . respuestas a tan grandes misterios ya podrian existir forma en que Dios utiliz6 las letras de su nombre (nuestros dentro de las tradiciones mas antiguas, en una forma elementos quimicos) para crear el universo, el mundo y nues- que todavia no hemos reconocido. tros cuerpos. Mediante esa comprensi6n, compartimos la esen- . • Los eruditos reconocen que mediante ediciones in- cia de Dios en 10 mas fundamental de nuestm c6digo genetico. A tencionales y mediante procesos naturales, la cadena Aunque el Sephar Yetzirah no es el unico texto que describe de conocimiento que une nuestras tradiciones mas estas relaciones, es uno de los mas completos. AI serlo, la com- antiguas con el mundo moderno se ha interrumpido prensi6n que se extrae de esta poderosa narraci6n llega a ser un ' en varias ocasiones. marco de referencia para entender los demas relatos de la crea- ) • El hecho de que en el siglo XX se hayan recuperado ci6n que tal vez son menos completos, induyendo las teorias textos y bibliotecas, como los Manuscritos del Mar cientificas de la evoluci6n y el creacionismo que exploramos Muerto y la Biblioteca Nag Hammadi, revela infor- en el Capitulo 2. Por medio de esta comprensi6n profunda, maci6n que habia estado oculta para los lectores en podemos encontrar las piezas faltantes y unir los numerosos general durante casi dos milenios. relatos de nuestro pasado, yen ocasiones de manera sorpren- dente. • Los eruditos consideran que el Sepher Yetzirah, el as- pecto de la Cabala mas antiguo, mas mistico y mas controvertido, es una colecci6n de metciforas que des- criben los procesos de la creaci6n en terminos abs- RESUMEN DEL CAPITULO 3 tractos. • Casi el 95 por ciento de la poblaci6n mundial cree • El descubrimiento de un vinculo directo entre las en la existencia de un poder superior 0 Ser Supremo, letras hebreas y los elementos de la vida indica que el de cierta descripci6n. Mas de la mitad de ellos se antiguo Sepher Yetzirah es un relato preciso de la ma- refieren a este poder como "Dios". nera en que Dlos us6 las letras de su nombre, nues- • A pesar de 10 buena que parece ser la ciencia, las men- tros elementos qu{micos, para producir el universo, tes mas privilegiadas de nuestro tiempo admiren que e1 mundo y nuesrros cuerpos. Capftu[o Cuatro EL CREADOR DEL UNIVERSO: En pa[abras de otras epocas E ncerrada en textos misteriosos, como el Sepher Yetzirah, la tradicion de la antigiiedad sugiere que en ella se nos est<l ofreciend) la identidad de nuestro Creador y el conoci- miento que forma un puente entre el mundo espiritual y el material. A traves de este conocimiento, se nos da el poder para sanar nu::stro cuerpo y traer paz a nuestra vida. Como sucede a menldo, los eruditos de la antigiiedad vieron tales secretos como una espada de dos mos. E110s crdan que ademas de ofrecer la "~abiduria de los cielos" y la clave para trascender los sufrimientos de la vida, la capacidad de tender un puente entre el cielo y la Tierra tambien tenia el poder de destruir rado aque110 por 10 que la humanidad se ha esforzado y ha lagrado. Se deja a los herederos de ese conocimiento el decidir si ese poder 11egaria a ser una bendicion 0 una maldicion. ~Seria posiSle que a 10 largo de nuestro avance como civili- ,.aeion, desde las hogueras en las que se quemaba madera hasta homos de microondas, hayamos dejado algo arras? ~Ser!a po- 82 EI C6digo de Dios El creador del universo 83 sible que las claves para sobrevivir a las mayores ?-menazas con- mas cercanas a la vida. La descripcion afirma que del polvo se tra nuestra existencia estuvieran enterradas en los registros mas formo "un pequeno germen de vida, luego un grumo 0 coagu- antiguos de nuestro pasado? De ser asi, entonces los descubri- 10, luego un cumulo de carne, completo en su hechura pero mientos de la ciencia y la tecnologia, en combinacion con el . mcomp 1eto... "4 Asi, e1 Quran agrega algo a las descripciones hecho de recuperar esos textos antiguos, han puesto la sabidu- de Adan proporcionando detalles sobre la forma en que el "pol- ria de los cielos a nuestro alcance por primera vez en mucho vo" se convirti6 en carne. tiempo. Ahora, nuestra tarea es comprender los mensajes que De manera similar, en las tradiciones occidemales, cuando nos dejaron quienes nos antecedieron. Ie preguntamos a alguien de que se hicieron los primeros seres humanos en la Tierra, la respuesta por 10 general es que esran Indicios compartidos de un pasado comun hechos de los mismos materiales que forman al mundo: mine- rales, agua y aire. Para apoyar tales afirmaciones, a menudo se Entre los temas recurrentes en los relatos aq.tiguos de la crea"'; nos refiere al relato biblico de la creacion en el Genesis. La cion estan las descripciones del origen del hombre. A traves de . historia de Adan, que compareen mas de dos billones de per- indicios comunes que se entretejen en estos relatos, podemos' sonas en las tradiciones hebreas y cristianas, proporciona la entresacar destellos de los recuerdos mas antiguos de la mane- , descripci6n mas basica de los odgenes del hombre. El Genesis, ra en que se inicio nuestra "existencia" en este mundo. LisJ cnganosamente simple en su forma, relata el milagro de la crea- I tradiciones orales del Midrash y la antigua Cabala, por ejem-' cion humana en unas cuantas palabras: plo, describen como el Creador les pidio a sus angeles "que lei ((El Senorformo al hombre delpolvo de la tierra': 5 trajeran polvo de las cuatro regiones de la Tierra para con esc polvo crear al hombre". 1 En terminos muy similares, el Santo Quran dice que Di~' Palabras diferentes, mismo significado creo a la humanidad con elementos naturales: "Te creamos con, A traves de los matices de la cultura, existen momentos en que polvo". 2 Sin embargo, en otro punto del Quran, el nacimiento, las relaciones suciles que menciona una tradicion se pierden de la humanidad se atribuye al hecho de que Dios utilizo Ull, cuando se traducen a otro idioma. Aunque es posible que la fluido, diciendo: "Fue Dios quien creo al hombre con agua".' versi6n original preserve una idea con una sola palabra, tal vez Aunque al parecer estas dos descripciones estan en conflicto, 110 exista una traduccion exacta para esa palabra en el nuevo un analisis mas profundo de los versos resuelve el misterio. ' idioma. En la primera descripcion, la historia de que Adan se origi-' En el sanscrito de la antigiiedad, por ejemplo, 'la palabra na del, "polvo" es parte de una secuencia mayor que describe !mIna describe el campo vivieme de la energia que rodea e los sucesos que llevaron a la primera manifestaci6n de vida. lI11pregna ;l toda vida. En ingles (y otros idiomas modernos), Los versos revelan que despues del origen de Adan como "pol- ("I concepto de energ{a vital se ha pasado por alto hist6rica- vo", empez6 un proceso en el que empezaron a surgir formal mente. No existe en estos idiomas una palabra con el significa- 84 El C6digo de Dios El creador del universo 85 do preciso de prana. Para transmitir ese concept,o, debemos derive de adamah, de hecho nos muestra que el primer ser arreglarnoslas utilizando palabras que, por si mismas, no tie- humano se formo como se formaron los elementos de la Tie- nen una relacion directa con la idea original. rra. Una traduccion muy literal dirla que Adan es la persona, 0 Combinando la palabra vida para indicar que estamos ha- el s:r h~~ano "de la tierra". A traves de esas sutilezas del len- blando de sistemas vivientes, yla palabra jUerza que implica guaJe onglll~l, se nos muestra que el hombre y la Tierra com- un campo de energia que brota del interior del propio sistema, parten un ongen comlin. se tiene como resultado la frase "fuerza vital". Aunque la defi- nicion de las dos palabras en forma independiente no tiene De Aclan a Hermes: relacion con la palabra prana, la frase que la sustituye: jUerza Relatos de secretos prohibidos vital, nos permite reconocer, en nuestro idioma, la sutil ener- gia de los sistemas vivientes. ~asta el nacimiento de la biologia molecular en el siglo XX, la La descripcion del primer ser humano en el Genesis es otro l~ea d: que estuvieramos formados de los elementos mas sen- ejemplo de la manera en que esas sutilezas se pierden en la c~llos" ~l polvo de la tierra", ha permanecido como un princi- traduccion. La primera porcion del Antiguo Testamento Cris- plO, basico . de la comprension humana . QUl'za' las t ra d'lClOnes . tiano se deriva de los cinco primeros Iibros de la Tora. La tradi- mas ~n~Iguas que describen esta relacion son las de la antigua cion hebrea declara que Moises recibiolos libros que conocemos a~qutmta. En su forma mas sencilla, la alquimia podria defi- como Genesis, Exodo, Levitico, Nlimeros y Deuteronomio < mr~e como una filosofia de la naturaleza. T~mbien podrfa de- hace casi 3500 afios, en ellenguaje de su tiempo.: el hebreo fimrse c~mo el uso de esa filosofia para cambiar, 0 transmutar, antiguo 0 "biblico". Es posible que al traducir el hebreo anti- la matena de una a otra forma. guo a idiomas como el ingles se oscurezcan los matices de los ~egUn la leyenda, los secretos de la alquimia del cielo y de sucesos clave que se describen en la Tora. la TIerra fueron revelados originalmente a Adan, el primer hom- Como hemos notado en traducciones inglesas, la relacion . bre de nuestra especie. AI describir el proceso mismo que fue biblica entre la humanidad y la Tierra nos describe como seres .' ~esponsa~l~ ,de su creacion, la tradicion hebrea afirma que un creados de "polvo". Aunque esta descripcion es adecuada en a~gel ~eciblO a Adan en la puerta del Eden y 10 instruyo en los terminos generales, pues nos dice que estamos hechos de ele- ITIlstenos , de la . , Cabala y los elementos . AI m'lsmo tiempo, . eI mentos naturales, es posible que la descripcion precisa de nues- angel prometlO que cuando la humanidad hubiera dominado tros odgenes se preserve mejor en la version original. l~ ,sabidurfa de estas "inspiradas artes", terminarla la maldi- En hebreo, la palabra que significa hombre es ''Adan'' CIOn del fruto prohibido yel hombre podr(a regresai al "Jardin (ADM), que se deriva de la raiz adamah. Es interesante que del Sefiar".6 adamah sea tambien la palabra hebrea que significa "tierra", 10 , Aunque la Fuente de las formas mas tradicionales de la al- l',uim.ia n~ ~s, clara, la creencia comlin es que esta antigua 7 que indica una relacion mucho mas directa y personal entre Ad:in y nuestro mundo. EI hecho de que la palabra Adan se l JenCla se 1ll1C16 con la legendaria FIgura egipcia de Toth, co- 86 EI C6digo de Dios EI creador del universo 87 nocido tambien como Tehuti y Djehuti. En lo~ muros de los nuestra comprensi6n inicial de la naturaleza y las ciencias templos y en los papiros se Ie representa con el cuerpo de un modernas. Aunque la alquimia en si ha sido reemplazada por hombre y la cabeza de un ibis de pico largo; muchos de los su descendiente, la quimica, descubrimientos recientes sugie- avances que separan a Egipto de otras civilizaciones de su epo-: ren que las sutiles relaciones que originalmente se describieron ca se atribuyen ala sabiduria de Toth. Ademas de haber intro- en ellenguaje de la alquimia pudieron perderse en sus traduc- ducido la escritura, la ley y la medicina en el antiguo Egipto, la .• ciones modernas. tradici6n mistica sugiere que Toth tambien divulg610s secre- ". Desde la perspectiva tanto de la alquimia como de la astro- tos alquimicos de la naturaleza. logia, las ciencias que han evolucionado a partir de ellas en la Se dice que la sabiduria de los secretos de Toth se registr6 i actualidad, incluyendo a la quimica, la fisica y la astronomia, en 42 libros que mas tarde se incorporaron a textos distintos estan incompletas. Hasta hace poco, cada una se concentr6 que se conocen como las Tablas Esmeralda. 8 Conforme los grie- I en los aspectos fisicos de su estudio; 10 que podemos "ver", yen gos absorbieron los conocimientos de los egipcios, las tradicio-i gran medida ignor6 los campos de energia sutil que son res- nes de la alquimia tambien continuaron; yToth se transformo ponsables del nacimiento de las estrellas y del comportamien- en el maestro griego de los principios hermeticos, Hermes Tris-' to de los atomos. Aunque la ciencia ha comprobado ser eficaz megistus (que significa "nacido tres veces"). Varias tradiciones / para cambiar la forma de la materia ya existente, combinando hermeticas, como la medicina homeopatica que se basa en los '( los elementos para producir metales mas fuertes y menos pesa- principios de "10 similar trata a 10 similar" y "como 10 de arri-i dos, por ejemplo, 5610 en los ultimos anos del siglo XX se con- ba, iguallo de abajo", continuan hasta nuestros dias. '( sideraron seriamente las cualidades de elementos que no se A partir de estas leyendas, se sugiere que la ciencia de la i pueden ver. AI reconocer los efectos de campos "invisibles", alquimia es una de las dos ciencias mas antiguas que conoce " las ciencias modernas, como la fisica cuantica, estan empezan- la humanidad. La segunda es el estudio de los cuerpos celestes • do ahora a reconocer la interrelaci6n de los elementos de la conocida como astrologta. Se cree que ambas son las claves para' : creaci6n y 10 que estas relaciones de rakes tan profundas signi- redimir a la humanidad de la "caida" que ocurri6 al inicio de : hcan en nuestra vida. nuestra historia, y que son de inspiraci6n divina. La alquimia del fuego, el aire y el agua Reg;stros antiguos de las primeras ciencias Para algunos, la palabra alquimia trae a la mente laimagen del En el nivel mas basico, la filosofia de la alquimia de la antigiie- mago barbado de una epoca oscura de la historia, que trabaja dad se parece mucho a nuestra practica actual de alterar y com- en una habitaci6n fria y sin ventanas, en las profundidades de binar los elementos de la Tierra para dar forma a nuevos un castillo medieval, rodeado de partes disecadas de cuerpos productos que nos sean utiles: la quimica moderna. Es claro de animales y de recipientes en los que hierven liquidos miste- que el conocimiento de los alquimistas sirvi6 de vinculo entre riosos. Esra visi6n es eI resultado de la forma en que eI cine y 88 El C6digo de Dios El creador del universo 89 i las novelas modernas han representado a los alquimistas. En la:: "negativa" que atrae 0 recibe, y en el centro la "neutral". (Ver la actualidad, podemos encontrar registros que describen formas,\ I 'igura 4.1). titiles de combinar los productos de la naturaleza que se utili-" zaron en las tradiciones mas antiguas y bien establecidas de la! historia. A partir de tablillas de arcilla, de los muros de los! templos, de pergaminos preparados meticulosamente y de tra-\ diciones orales, hemos aprendido que los fundamentos de la alquimia fueron conocidos por los fenicios, los babilonios y los caldeos, al igual que en Oriente, en Roma yen Grecia. En general, la base de los estudios alquimicos empez6 con:,: un solo principio segtin el cual todo nuestro mundo, y todo 10: que hay en el, esta hecho de tres elementos ~encillos: Esos ele..: mentos, bien conocidos para quieries estudian las tradicione$ Figura 4.1: Ejemp10s que representan 10 "positivo", 10 "negativo" y el sagradas, son el Fuego, el Aire y el Agua. AI carecer de vocabu~l \'lluilibrio" en diferentes visiones del mundo. lario ciendfico para describir este conocimiento, los eruditos, de la alquimia hicieron 10 que pudieron para preservar y trans~: Esto incluye la tradicion cristiana del Padre, Hijo y Espiri- mitir la sabiduria que posdan, que ya en su epoca era una tu Santo, los animales de las culturas indigenas que represen- 1 sabiduria antigua. Si pudieramos "traducir" las ideas mas sim. un a la Tierra, al cielo y a las criaturas que hay en medio Oa pIes de la alquimia sobre el Fuego, el Aire y el Agua a sus equi",. labIa menClona las tradiciones nativas de los Andes), al igual valentes en la quimica modema, ~que secretos nos reveladan; 'Iue los fundamentos de la fisica del siglo XX: el proton, el elec- rnOlO y el neutron. Aunque descubrimientos recientes en el ahora las antiguas f6rmulas? (ampo de la fisica cuantica estan cambiando nuestro punto de ,ista sobre el atomo en si, las "nubes de la probabilidad" que La creaci6n como una tri logfa "stan reemplazando a gran velocidad a las particulas imagina- En ellenguaje de la era de la alquimia, Fuego, Aire y Agua' lias del pasado, siguen presentando la trilogia de atributos (po- representaban los extremos de polaridad y equilibrio. Utili- '''livo, negativo y neutral) que se relaciona con los protones, zando trilogias de elementos para describir la creaci6n, el "Fue- II lS electrones y los neutrones go" se equipara con dar, 0 con el aspecto "masculino". El ''Agua'' Aunque en las primeras descripciones se identificaban tres con recibir, 0 con el aspecto "femenino". Y el ''Aire'' con el ('lcmentos, quienes entendian el orden natural de nuestro mun- (II) siempre intuyeron la existencia de un cuarto elemento se- importantfsimo equilibrio neutral que esta en medio, es decir, ITelo. El elemento faltante, la Tierra, se menciona en forma el "hijo". Muchas tradiciones comparten un fundamento de estas tres propiedades: la "positiva". que afirma 0 proyecta; la l'xplicita ell tradiciones akjuimicas posteriores. I,os escribas 90 EI C6digo de Dios EI creador del universo 91 anteriores al cristianismo de los Manuscritos del·Mar Muerto, La ciencia mfstica de la Cabala los antiguos esenios, describieron estas cuatro fue~a~ como "angeles" y los nombraron de acuerdo a esa descnpcl6n: El , Por claridad, utilizaremos el termino alquimia tradicionalpara angel del Viento, el angel del Sol, el angel del Agua y el angel describir 10 que a menudo se considera como la forma medie- de la Tierra. Los alquimistas creian que comprender c6mo sur- val de laciencia. Aunque los misterios de la alquimia tradicional gi6 el cuarto elemento era la clave para comprender la crea- estan bien documentados y estan disponibles, los principios que ci6n, la vida y la inmortalidad. . i los fundamentan son menos obvios. Para preservar los secretos Aunque los detalles de estas visiones del mundo obvlam~n~e de la "ciencia mas antigua" en una epoca en que ese conoci- son antiguas y su vocabulario pertenece a otras. epocas, la Slml- miento Ie costaba la vida a la gente, el significado de los simbolos litud que existe entre los relatos mejor establecl~o.s.de nuestros que forman el centro de la alquimia tradicional se envolvi6 en odgenes no puede negarse. 5i aceptamos la PO~I~lhdad de que misterio durante la Edad Media. Incluso hoy en dia, los deta- nuestros ancestros estaban tratando ~e transrnltlr una podero- lles de la "primera ciencia" permanecen ocultos para todos, sa ensefianza a sus descendientes, 10 que nos incluye a noso- excepto para aquellos que estan directamente involucrados en la tradici6n, con el fin de evitar el mal uso de su poder. tros, la gente del futuro para ellos, Nue poddan estar diciend~? .Nuestros precursores cientlficos simplemente nos estaban dl- Vnos dos mil afios antes de la alquimia tradicional, sin ~iendo que el calor, el Hquido, el aire y los minerales forman; embargo, unaforma de alquimia attn mds antigua nos ofrece 10 nuestros cuerpos y rodo 10 que vemos? ~O tal vez estaban com- , que tal vez es el registro mas completo de los odgenes de la creaci6n y nuestra relaci6n con nuestro Creador. Me refiero a partiendo algo mas preciso? Las evidencias qu~ se.presentan ~n la porci6n de la Cabala que describe al universo utilizando las 10 que queda de este capitulo y en los dos ~lgUlentes,. s~gle­ combinaciones precisas de las letras hebreas: el Sepher Yetzirah. ren que en el vocabulario de su epoca, l~s antlguo~ a~qUlmlstas; . estaban describiendo la estructura preClsa, fa quzmzca real, de .~ A 10 largo del Sepher Yetzirah aparecen frases entrelazadas la Tierra y de nuestras celulas. con referencias tipo alquimista. Los versos describen las inte- jVistas con los ojos del analisis ciendfico ~e nuestros dias), . racciones mas antiguas del fuego, el aire y el agua, represen- tando a estos elementos con las letras del alfabeto hebreo. AI las antiguas f6rmulas del agua, el fueg~ y el al.re han compr~- ~ bado ser sorprendentemente exactas! 51 asumlmos que las dl-· describir la uni6n entre el cielo y la Tierra, se nos incluye como ferencias de lenguaje es 10 unico que se interpone entre el . parte de esa creaci6n. En estas antiguas descripciones, encon- conocimiento moderno y la sabiduda de la antigliedad, en- tramos un vinculo directo con los principios de la naturaleza tonces la clave de los conocimientos profundos que mas poder en la alquimia tradicional; y la primera clave para interpretar nos dadan poddan existir en una forma que todavia no hemos el mensaje que esta en el interior de nuestras celulas. reconocido. 90 El C6digo de Dios E1 creador del universo 91 anteriores al cristianismo de los Manuscritos del Mar Muerto, La ciencia mfstica de la Cabala los antiguos esenios, describieron estas cuatro fue~a~ como Por claridad, utilizaremos el termino alquimia tradicional para "angeles" y los nombraron de acuerdo a esa descnpc16n: £1 describir 10 que a menudo se considera como la forma medie- angel del Viento, el angel del Sol, el angel del Agua y el angel de la Tierra. Los alquimistas crdan que comprender c6mo sur- val de la ciencia. Aunque los misterios de la alquimia tradidonal gi6 el cuarto elemento era la clave para comprender la crea- estan bien documentados y estan disponibles, los principios que ci6n, la vida y la inmortalidad. i los fundamentan son menos obvios. Para preservar los secretos de la "ciencia mas antigua" en una epoca en que ese conoci- Aunque los detalles de estas visiones del mundo obviam~n~e son antiguas y su vocabulario pertenece a otras epocas, la Slml- miento Ie costaba la vida a la gente, el significado de los sfmbolos que forman el centro de la alquimia tradicional se envolvi6 en litud que existe entre los relatos mejor estableci~o.s.de nuestros misterio durante la Edad Media. Incluso hoy en dfa, los deta- odgenes no puede negarse. Si aceptamos la poslblhdad de que lles de la "primera dendi' permanecen ocultos para todos, nuestros ancestros estaban tratando de transrriitir una podero- sa ensefianza a sus descendientes, 10 que nos incluye a noso- ' excepto para aquellos que estan directamente involucrados en la tradici6n, con el fin de evitar el mal uso de su poder. tros, la gente del futuro para elIos, ~que poddan estar diciend~? Vnos dos mil afios antes de la alquimia tradicional, sin .Nuestros precursores cientfficos simplemente nos estaban dl- ~iendo que el calor, el Hquido, el aire y los minerales forman embargo, unaforma de alquimia aun mds antigua nos ofrece 10 que tal vez es el registro mas completo de los odgenes de la nuestros cuerpos y todo 10 que vemos? ~O tal vez estaban com- creaci6n y nuestra relaci6n con nuestro Creador. Me refiero a partiendo algo mas preciso? Las evidencias qu~ se. presentan ~n la porci6n de la Cabala que describe al universo utilizando las 10 que queda de este capitulo y en los dos ~lgUlentes,. s~gle­ combinaciones precisas de las letras hebreas: el Sepher Yetzirah. ren que en el vocabulario de su epoca, los annguos alqUlmlstas estaban describiendo la estructura precisa, fa quimica real, de A 10 largo del Sepher Yetzirah aparecen frases entrelazadas con referencias tipo alquimista. Los versos describen las inte- la Tierra y de nuestras celulas. racciones mas antiguas del fuego, el aire y el agua, represen- iVistas con los ojos del analisis ciendfico ~e nuestros dias, , tando a estos elementos con las letras del alfabeto hebreo. AI las antiguas f6rmulas del agua, el fuego y el aue han compro- . describir la uni6n entre el cielo y la Tierra, se nos incluye como bado ser sorprendentemente exactas! Si asumimos que las di- " parte de esa creaci6n. En estas antiguas descripciones, encon- ferencias de lenguaje es 10 unico que se interpone entre el tramos un vinculo directo con los principios de la naturaleza conocimiento moderno y la sabiduda de la aritigliedad, en- ' en la alquimia tradicional; y la primera clave para interpretar tonces la clave de los conocimientos profundos que mas poder cl mensaje que esta en el interior de nuestras celulas. nos dadan poddan existir en una forma que todavia no hemos . reconocido. 92 El C6digo de Dios El creador del universo 93 El Arbol de la Vida: Un plano del Universo La narraci6n del Sepher Yetzirah empieza con una descripci6n de los diez mundos, 0 Sefirot, que definen la relaci6n entre las fuerzas de la creaci6n. Sorprendentemente, las teorias mas re- cientes de la creaci6n tambien mencionan que nuestro univer- so se compone de al menos diez dominios de energia; diez dimensiones. jEstos mundos sutiles de hecho son necesarios para explicar las observaciones de la fisica cuantica! Los Sefirot .( se representan como esferas, y se colocan de tal manera que ' forman el familiar modelo del Arbol de la Vida (ver la Figura' 4.2). A partir de este arbol, las ensefianzas de l~ Cabala ofrecen significado y relevancia dentro del contexto de nuestra vida .' cotidiana. Cada Sefirot representa un atributo particular con el que Dios cre6 el universo, y al cual nosotros podemos aspirar en nuestra vida. Por ejemplo, el segundo y tercer Sefirot, Binah y .• Hokhmah se ejemplifican en los principios de la comprensi6n y la sabiduria, mientras que el cuarto y el quinto, Gevurah y I Hesed, representan las cualidades de discernimiento y miseri- cordia. El segundo capitulo del texto presenta la primera conexi6n clara~ntre la naturaleza mistica del Arbol de la Vida y algo mas concreto en nuestro mundo. La clave esra en las tres pri- meras letras que Dios us6 para crear el universo y que en el alfabeto hebreo se conocen como las Fundamentales, las Ma- I dres 0 las Letras Madres: Alef(A), Mem (M) y Shin (Sh). Aun- que cada una de las demas letras (19) del alfabeto est:l impregnada de su propio poder y significado, este libro se con- centrara en las primeras tres, yen ellugar especial que tienen Figura 4.2: El 'Antigua arbol hebreo de la vida' que muestra los atributos en la creaci6n. de este mundo como los dicz Sefirot (scgun Halcvi).9 94 El C6digo de Dios El creador del universo 95 En terminos bastante claros, el texto declara que a traves ment~s que forman el universo. En la siguiente descripci6n de de estas letras, y s6lo de estas letras, puede encontrarse el ori- los pnmeros cuatro Sephirot, cada afirmaci6n detalla el ele- gen del misterio de la creaci6n. Las Tres Madres se relacionan mento al eual se Ie da vida. de inmediato con los elementos de la creaci6n que se conocen en la alquimia: fuego, aire y agua. En el mismo contexto que 1. Diez Sephirot de Nada: Uno es el aliento del Dios viviente. identifica los elementos, una sola frase de amplio significado Bendito y bendecido es el nombre de la vida de los mundos. La deja en claro su relaci6n con el universo y mas alia: voz del aliento y el habla. Y tste es el aliento santo. 12 Las tres letras fu ndamentales, A, M, Y Sh, son un gran 2. n,os: Aliento queproeede de aliento. Con t4 Diosgravoy escul- seereto oculto y mlstieo, del eual emanan el Fuego, ptolos cuatropuntos eardinales (alientos) del cielo: Este, Oeste, Norte y Sur. Y hay un aliento en eada uno de e!los.13 el Aliento y el Agua, a partir de los cuales se ereo todo. 1O 3. Tres: Agua queprocede del aliento: Con ella, .HI gravo y escul- Pare entender el misterio de A, My Sh, y las implicaciones pio el caos y el vado, la arcilla y elpantano... Vt-rtiO agua en de este enunciado, es necesario sefialar la sabiduda que es la elias (las letras) y se eonvirtieron en polvo, eomo estd eserito. 14 esencia de la propia Cabala. Como dijo Halevi: 11 "Las relacio-' 4. Cuatro: Fuego que procede del agua. Con t4 Dios gravo y es- nes que se presentan el en Arbol de la Vida subyacen la totali·: 1 eulpiO el Trono de Gloriay todos los ejereitos de 10 alto. Asl estd dad de la existencia". Los conceptos que se ofrecen en el Arbol eserito: hizo a sus dngeles eon alientos, y a sus ministros con de la Vida son tan amplios que al parecer se han aplicado a una:' flamas de fuego. 15 infinidad de temas, desde las razones del matrimonio, el di- ' 1 vorcio, la enfermedad y la salud, hasta la fisica de la creaci6n. En la manera en que se definen el principio y elperiodo ante- Despues de estas descripciones iniciales, el texto continua rior al prineipio, utilizando los elementos que representan las " con un grado de claridad que deja pocas dudas con respecto a letras hebreas, Ie encontramos significado al misterio de las tres, la relaci6n entre las Letras Madres y los elementos: Letras Madres. En unas cuantas frases, el Sepher Yetzirah usa el Arbol de la , Vida como una metafora de la creaci6n, declarando que el, "Tres Madres, A, My Sh, en el primer Sephirot representa el ''Aliento del Dios Viviente." Por universo son aire, agua, fuego "16 tradici6n, los estudiosos de la Cabala interpretan esto como una descripci6n del momento de la creaci6n, el primer aliento Una vez que se establecen los atributos del fuego, el aire y o la primera luz, y tambien como la primera sustancia de la el agua, el texto dedara que los bloques de construcci6n estan que se form6 todo 10 demas. Despues del Principio, se guia al ' en su lugar, y el acto de usarlos para el milagro de nuestro lector en una travesia alquimica en la que se derivan los de- universo puede continuar. A traves de los demas Sephirot, el 96 El C6dige de Dies El creador del universe 97 Arbol de la Vida define los limites del Universo de Dios y las angel del viento. De manera similar, el "agua que proviene del reglas de la creacion. Aqui tambien encontramos la dave que aliento" se convierte en el elemento agua yen el angel del agua, une a las tres Letras Madres con los elementos modernos de mientras que el "fuego que proviene del agua" se convierte en nuestro mundo fisico y con el milagro de la vida. fuego y en el angel del Sol. Tomando en cuenta estos vinculos, surge esta pregunta: ~Que une a estas letras antiguas de la crea- El surgir de las Tres Madres cion con la quimica de la ciencia moderna? Despues de estos pasajes, se nos explica que A, My Sh son mas que simples simbolos de los elementos de la naturaleza. Se les Pasando del "por quell al"como" describe como una forma de "alquimia verbal", y los versos Gran parte de la tecnologia de nuestros dias se basa en modifi- nos muestran como el conocimiento y el poder de cada letra es car procesos que historicamente se han dejado a la naturaleza. la dave para comprender las fuerzas del uni,,-erso. Desde influir en las pautas del dima y crear formas nuevas de materia, hasta la ingenieria genetica en el campo de las plantas ('El hizo de La letra Alefel rey que gobierna el alient/ 7•... y las enfermedades, para diseliar cada una de estas tecnologias El hizo de Mem el rey que gobierna el agua 18••.• aparentemente milagrosas, fue primero necesario comprender El hizo de Shin el rey que gobierna elfUego.... "19 por que funcionan los procesos naturales. Desde la perspectiva de nuestros antepasados, sin embar- En terminos que han sobrevivido ante las pruebas del tiem- I go, habia poca necesidad de este tipo de informacion. Los sa- po y de las traducciones, estas descripciones testifican la pro-, nadores, los alquimistas y los obradores de milagros de la fundidad del conocimiento que poseian los autores del texto, ; antiguedad se preocupaban menos por entender por que nues- al igual que su gran capacidad para transmitir 10 que sabian en . . tro mundo funciona como 10 hace, y se preocupaban mas por un lenguaje que sigue teniendo significado en la actualidad. AI: como aplicar los antiguos principios de la naturaleza a sus vi:- carecer de un lenguaje cientifico, parece que los antiguos trans- . das. Como no estaban tratando de mejorar la naturaleza, ha- mitieron la sabiduria que heredaron de una Fuente aun mas bia poca necesidad de diseccionarla para que sus familias, sus antigua que todavia no se ha identificado. iCon las unicas pa- aldeas y sus comunidades se beneficiaran de ella. labras que conodan, describieron nada menos que la cons- El poder de la oracion para lograr la sanacion, un fenome- truccion del universo! no que la ciencia moderna y la medicina occidental estan em- Esta descripcion de los primeros actos de la creacion tiene pezando a explorar con seriedad, ofrece un ejemplo perfecto un paralelo muy cercano con la alquimia tradicional de la Edad de esta distincion. En un estudio piloto llevado a cabo en el Media, asi como con la creacion de los angeles de la naturaleza Instiruto de Cardiologia Mid America de Kansas City, 990 descrita por los Esenios unos 500 alios antes del nacimiento pacientes con diversas af<ycciones cardiacas serias se dividieron de Jesus. Aqui el "Aliento de Dios" se convierte en aire y en el en dos grupos antes de ser sometidos a los procedimientos 98 El C6digo de Dios El creador del universo 99 medicos 0 cirugias que se les habian prescrit~.21 Un grupo el desarrollo de las computadoras y el almacenamiento de da- recibio tratamientos relacionados con la oracion de manos de tos) en una sola generacion hemos reunido cantidades sin pre- cinco voluntarios que trabajaban con ellos diariamente) mien- cedente de datos. El Dr. Michiu Kaku describe la fantastica tras que el otro grupo no 10 recibio. velocidad de nuestra capacidad para reunir conocimientos di- Para el asombro de los investigadores que lIevaron a cabo ciendo: "El conocimiento humano se esta duplicando cada 10 las pruebas) los individuos que estaban en el grupo que recibi6 anos. En la ultima decada [de 1987 a 1997] se ha generado mas oraciones experimentaron beneficios estadfsticamente calculables conocimiento cientffico que en toda la historia de la humani- en su proceso de curacion y recuperacion. El investigador en d ad ".23 La h·lstona ' reve1ar que el conocimiento sin pre- . po d na jefe del proyecto declaro: "Las pacientes por quienes se rezo cedente que ahora se tiene sobre la Tierra empezo con la respondieron mejor".22 Los resultados de este estudio recibie-" investigacion cooperativa de mayor magnitud del ultimo si- ron publicidad lIegando a los titulares de los periodicos a nivel glo: el Ana Geofisico Internacional (IGY, de las siglas en in- nacional y han motivado estudios posteriores en el Centro!; gles: International Geophysical Year). Medico de la Universidad de Georgetown y en la Universidad,' Durante un periodo de 18 meses) de julio de 1957 a di- de Harvard) en un esfuerzo por comprender con precision por": ciembre de 1958) 67 naciones participaron en un proyecto que el grupo que recibio oraciones tuvo muchos mejores re-'l unico para documentar la composicion y el proceso natural de sultados. i la Tierra de una manera en que nunca antes se habia hecho ni Aunque estas investigaciones son interesantes) muchas dei, 24 se ha vuelto a hacer. Lo ironico es que precisamente estos las personas que habitualmente incorporan la oracion en SUi f datos modernos son los que ahora nos permiten tender un vida todos los dias podrian sentir que este tipo de estudios no : puente entre los principios de la antigua alquimia y la ciencia es necesario. Ya aceptaron el poder de la oracion y la capacidad! mas sofisticada de nuestro tiempo. que ellos tienen para compartir ese poder con otros. Como ya,'! En los textos de la alquimia de la antiguedad) el elemento saben que la oracion tiene resultados) no se preguntan por que Aire nuncase define con claridad. Interpretaciones posteriores los tiene. suponen que se refiere al aire que respiramos. La ciencia moder- na demuestra que) de hecho) nuestra atmosfera nos nutre con La ciencia confirma un modelo antiguo: el elemento invisible que da vida a cada celula de nuestro cuer- Se consideran de nuevo po: el oxfgeno. Por tanto) al correlacionar la alquimia de la el airel el agua y el fuego antigiiedad con la quimica moderna) supusimos que el oxigeno es el equivalente al Aire de la alquimia. No obstante) el estudio A finales del siglo XX, los descubrimientos nos dieron el po- de nuestra atmosfera que se llevo a cabo durante el IGY revelO der de dar forma a la naturaleza. Anteriormente, la concentra- que no es a)"f. Aunque el oxigeno es indudablemente el ele- cion de la ciencia habia estado ante todo en recopilar mento del aire que mas necesitamos para vivir) jhay relativa- informacion que explicara nuestros cuerpos y el mundo. Con mente poco oxlgeno presence en d aire que respiramos! 100 El C6digo de Dios El creador del universo 101 Un 78 por ciento de nuestra atmosfera se compone de otro atomos de hidrogeno por cada atomo de oxigeno, los atomos elemento que se combina con eloxigeno para estabilizar el aire. de oxigeno son mas grandes, 10 que explica el porcentaje mas Aunque los estudios del IGY revelaron que el oxigeno repre- alto en la composicion). Para nuestros propositos, considere- senta el21 por ciento de nuestra atmosfera, (el argon, el bioxi- mos que las referencias antiguas al agua son una clave que re- do de carbono y algunos microelementos constituyen el resto presenta al elemento oxigeno. de nuestro aire),25 jla mayor parte del contenido de cada respi- I Por 10 general se cree que las referencias alquimicas al fue- racion que sostiene la vida es nitrogeno! go representan la energia que es la fuente original de todo fuego: Cuando los antiguos alquimistas identificaron al aire como el Sol. A final de cuentas, los fuegos que han consumido ma- un elemento primordial de la creacion, ~es posible que nos ' dera, carbon y otros combustibles que se han utilizado a 10 estuvieran diciendo, en ellenguaje de su tiempo, que el nitro- largo de la historia, son posibles debido a la energia del Sol geno es la sustancia a la que se referfan? Para nuestro proposi- que se libera en su interior. En la ultima mitad del siglo XX, to, supondremos que ese es el caso y veremos ~ dande nos lleva los avances tecnologicos han hecho posible un analisis detalla- esta correlacian. Una Hnea similar de razonamiento podrfa apli- do de los elementos que componen el cuerpo ardiente que esta carse a los elementos modernos que corresponden al fuego, al en el centro de nuestro sistema solar. agua y a la Tierra de la alquimia. El calor que sentimos en un calido dia de verano se debe El agua que representa mas de dos terceras partes de la ante todo a las temperaturas inimaginables que se generan en superficie de nuestro planeta se describe quimicamente me- el centro del Sol (jse cree que llegan a 27 millones de grados diante la formula de todos conocida: H 2 0. En los terminos Fahrenheit!). La ciencia considera que nuestra estrella mas cer- mas sencillos, esta formula nos dice que en los oceanos, lagos, . cana es una enorme maquina celestial que quema una canti- rfos y corrientes de agua de la Tierra, en la lluvia, en el firma- dad limitada de gases y que 10 hara hasta que su dotacion se mento y en el agua de nuestro cuerpo, hay dos atomos de hi- termine. Estudios recientes confirmaron que el combustible drogeno por cada atomo de oxigeno. Si adoptamos el mismo del fuego solar son dos elementos primordiales. Consta de punto de vista de que el aire es una palabra clave que significa aproximadamente un 71 por ciento de hidrogeno y un 27.1 hidrog<::no, quizas agua es una palabra clave que describe otro por ciento de helio. 27 elemento fisico. Siguiendo la l6gica que se aplica a los elementos de la al- Basandose en porcentajes, los estudios de la NASA indican quimia, podemos asumir que las referencias antiguas al fuego, que el agua esta bajo el dominio del elemento invisible llama- son de hecho, referencias al elemento que produce la fuente de do oxigeno. El agua que cubre aproximadamente dos terceras todo fuego: el hidr6geno. A partir de estos descubrimientos, partes de nuestro mundo esta hecha de un 85.8 por ciento de ahora es posible traducir las antiquisimas referencias al fuego, oxigeno (mas 0 menos un 88.89 por ciento de agua pura), al aire y al agua como elementos qufmicos reconocidos por la mientras que el porcentaje restante incluye hidr6geno y diver- ciencia moderna (ver la Figura 4.3). sos micro-minerales. 26 (Aunque la f6rmula indica que hay dos 102 El C6digo de Dios El creador del universo 103 que en ocasiones 10 absorbemos del entorno como un produc- to secundario de la industria y la contaminaci6n. Habiendo establecido un vinculo directo entre las descrip- ciones antiguas de nuestro cuerpo y sus equivalentes en la qui- mica moderna, ahora podemos relacionar la ciencia moderna con la Cabala. Si estas correlaciones son exactas, entonces los relatos que se han preservado como fabulas de la alquimia y tradiciones de la Cabala empiezan a asumir un significado mas profundo. jUna nueva interpretaci6n de la descripci6n mas Figura 4.3: Traducciones modernas de los antiguos elementos de la creaci6n. antigua y mas completa de nuestros orfgenes revela respuestas nuevas y asombrosas a preguntas que no era posible contestar en el pasado! Mediante estudios como los del IGY, ahora sabemos que son relativamente pocos los elementos que forman la corteza RESUMEN DEL CAPITULO 4 externa de la Tierra, 10 que incluye las capas que estan bajo los, • Un tema comlin en los relatos antiguos sobre el ori- oceanos. Silicio, oxigeno, hidrogeno y aluminio forman mas gen de la humanidad es que fuimos creados del "pol- del 90 por ciento de la composicion de esta capa. iAlgo mucho:: vo" 0 de la "arcilla" de la Tierra. Toda vida viene del mas significativo es el descubrimiento de que dos de esos cua.. ' mismo polvo. tro elementos, el hidrogeno y el oxigeno, tambien forman mas' del 99 por ciento de nuestro cuerpo! • Los secretos de nuestra creaci6n y nuestra capacidad A partir de estos estudios unicamente podemos llegar ala!' para transmutar las circunstancias de la vida (tender conclusion de que en realidad estamos hechos "de la tierra'~ un puente entre el cielo y la Tierra) se preservan me- (ver "Palabras diferentes; mismo significado" en la pagina 79"1 diante las tradiciones ocultas de la alquimia de la an- 80). Claro que existen diferencias entre el cuerpo humano y l~: tigiiedad. En esas tradiciones, las claves indican que corteza del planeta. En nuestro cuerpo, los elementos carbono nuestro mundo y nuestros cuerpos estan hechos de y nitrogeno toman el lugar del silicio y el aluminio que se los elementos: fuego, agua y aire. encuentra en la tierra. De los elementos restantes, aunque el • Tambien encontramos una descripci6n detallada de silicio es una parte importante de nuestra constituci6n qufmi- ' los principios de la alquimia que llevan a la creaci6n ca, solo se encuentra en cantidades muy pequenas y por 10 del universo y a los orfgenes de la humanidad en el tanto se Ie identifica como un microelemento. Es interesante mistico Libro Hebreo de la Creaci6n, el Sepher Yetzi- que el aluminio no se encuentre en nuestro cuerpo en absolu- rah. Este libro puede conseguirse en la actualidad y, to como un elemento que se presente en forma natural, aun- en su totalidad, ofrece una descripci6n detaIlada se- 104 E1 C6digo de Dios gun la eual un poder superior form6 el. universo y nuestro mundo. • Nuevo descubrimiento: La ciencia moderna eonfirma los patrones antiguos, revelando que los elementos de la alquimia, fuego, aire y agua en realidad repre- sentan tres de los elementos mas abundantes en nues- tro euerpo: hidr6geno, nitr6geno y oxigeno, respeetivamenteo Capftu[o Cinco EL DESCUBRIMIENTO: Cuando [as [etras se convlerten en elementos E n una epoca en que el ritmo del conocimiento humano se esta duplicando cada diez aiios y la maquinaria puede reducirse al tamaiio de los atomos, todavia dependemos de los registros mas antiguos de nuestro pasado para entender quie- nes somos; registros preservados como las letras de los alfabe- tos de la antigiiedad. AI mismo tiempo, el origen de los alfabetos del mundo, y los lenguajes subsecuentes, permanece como uno de los mayores misterios sin resolver de nuestros tiempos.! En los 40,000 aiios de la historia del hombre moderno, el uso dellenguaje escrito ha tenido un papel cada vez mas im- portante en la preservacion y transmision de datos a otros en d presente y en el futuro. En este tiempo, hemos registrado los Sllcesos de nuestras vidas mediante un metodo de escritura 0 la lombinacion de las cuatro posibles formas de escritura. Estas tl>rmas se agrupan en cuatro categorias que se describen como \ague: 108 EI C6digo de Dios EI descubrimiento 109 • imagenes pictoricas tro de la explosion de una supernova en el ano 1054 de nues- tra era, esta pintado en un penasco de arenisca que sobresale • signos de palabras en el acantilado. Este fenomeno fue visible a plena luz del • signos que representan sflabas individuales dfa en America del Norte, y sus rastros son todavfa visibles • alfabetos completos para los astronomos en 10 que se conoce como la Nebulosa del Cangrejo. Aunque parece que esta pictograf{a es un registro del suceso en sf, no ofrece datos espedficos, como la hora del A traves de los sfmbolos, cada forma permite diversos gra- dfa, la magnitud del resplandor, ni los efectos del fenomeno dos de complejidad para representarse y ha respondido a las en la gente, los animales y las condiciones de vida de la epo- necesidades de determinados pueblos en epocas espedficas de ca. Simplemente registra el hecho de que ocurrio una explo- la historia. sion. Sin embargo, los astrologos chinos de ese mismo periodo documentaron el suceso a traves de un lenguaje alfabetico mas sofisticado, y por 10 tanto pudieron preservar datos espedficos Letras y alfabetos: para las generaciones futuras, como la fecha exacta en que Sfmbolos de una real1dad mas profunda ocurrio. Aunque el uso de alfabetos complejos es la forma de comuni- Los lenguajes de logogramas (signos que significan pala- cacion que se desarrollo mas recientemente, esto no implica . bras) y los silabogramas (signos silabicos) conservan un nivel que los pensamientos que estan detras de los sistemas de escri- . mayor de detalle que la pictograffa de la antigiiedad. AI utili- tura por medio de imagenes sean menos sofisticados que los' zar un sfmbolo para representar toda una sflaba 0 palabra, es- que estan detds de las palabras de nuestra escritura moderna. \ tas formas de escritura son capaces de preservar mayor cantidad Mas bien, son solo los sfmbolos en sf 10 que se ha vuelto mas de informacion con respecto a los sucesos que registran. 2 sofisticado al paso del tiempo. El metodo mas preciso para registrar informacion escrita Las formas mas sencillas de imagenes pictoricas, la picto- es mediante grupos de sfmbolos que representan sonidos espe- grafta, por ejemplo, por 10 general representan conceptos am- dficos; los alfabetos. En un alfabeto, los sfmbolos se combinan plios de alto nivel, sin proporcionar el tipo de detalles que dan para producir palabras que preservan informacion de manera mayor significado al suceso que se esta registrando. En el otro precisa y significativa. Se cree que la necesidad de registrar las extremo, los alfabetos permiten mencionar datos espedficol experiencias que se tienen es exclusivamente humana. Es el sobre un suceso que se va a registrar, transmitir y preservar' catalizador que llevo a nuestros antepasados a crear numerosos para su uso futuro. lenguajes y los alfabetos que los representan. Induso en el mejor Por ejemplo, la simple imagen de una explosion estelar en de los casos, sin embargo, las palabras formadas por las letras de la parte inferior de un acantilado del Canon Chaco en Nuevo lIll alfabeto solo son un sfmbolo del suceso 0 de la experiencia Mexico, ilustra el concepto. EI sfmbolo, que se cree es el regis- que narran. Imp/leitos m los slmb%s de las letras hay muchos 110 El C6digo de Dios El descubrimiento 111 estratos adicionales, cada uno con niveles mdsprofundos de signi- Cuando [as [etras son a[go mas que [etras: ficado. , ., . E[ c6cligo ocu[to de [a [engua hebrea Junto con la incertidumbre de sus OrIgenes, surglO un mlS- terio mas profundo relacionado con los multiples significados En el momento que arribaba el taxi ala puerta del museo, las que se relacionan con los lenguajes de la antiguedad..Los eru- filas de personas ya llegaban mas alIa de la entrada, llenando ditos reconocen abiertamente que desde los lenguaJes de la las escalinatas de cemento bafiadas con las gotas de una lluvia antiguedad y los lenguajes obsoletos del pasado hasta los len- primaveral. Mas temprano esa misma tarde, yo habia tenido una entrevista con una escritora de uno de los servicios noti- guajes mas modernos de hoy, los simbolos ~ue llama~os letras en realidad tienen un doble prop6sito. A myel exterIor, las le- ciosos nacionales en la cual se incluy6 una larga discusi6n so- bre los Manuscritos del Mar Muerto. tras forman las palabras y oraciones que almacenan y comuni- j can la informaci6n, como fechas, horas y sucesos. Detras de "jLos manuscritos estan aqui en la ciudad!" exclam61a es- critora al final de la entrevista. "En el Chicago Field Museum". estos significados, otros estratos men~s obvios- de informaci6n "~En serio?" respondi. "~Que tan lejos esta el museo de revelan relaciones sutiles dentro de las propias palabras. donde estamos ahora?". Gracias al poder de sus letras hebreas, la Tora tiene la pecu- liaridad de ser un documento hist6rico escrito a nivel externo, "Con trafico, quizas unos 15 minutos en taxi", respondi6. al igual que un libro guia escrito en clave sobre los secretos de ''Aunque he visto los manuscritos c6pticos en Egipto y he la creaci6n. Para quienes entienden la clave, las palabras son estudiado las palabras de los manuscritos extensamente, jnun- senderos hacia significados aun mas profundos del mismo tex- ca he visto los Manuscritos del Mar Muerto! Me gustaria ver- los", dije. "Quizas podriamos hacer una visita al museo". to. Los eruditos en el campo de la Tora creen que en el interior Eso fue todo. En unos minutos estabamos en un taxi en de las propias letras que registran las accion~s de Dios y de l~s direccion al museo. patriarcas existen claves secretas sobre los mllagros que descn- ben las palabras. Por ejemplo, asi como se revel6 un vinculo AI bajar del taxi en medio de un viento helado, sefiale las filas de gente. "~Estan aqui para ver los manuscritos?", pregunte. mas profundo entre "Adan" y "Tierra", :,n la ~ras~ de la Tora que dice: "Dios cre6 el cielo y la Tierra, el slgmficado mas ''Algunos'', respondi6 ella. "Pero muchos probablemente profundo de las palabras revela precisamente como se forma- estan aqui para ver a Sue". Sucedi6 que el momento que elegi- mos para nuestra visita para ver los manuscritos coincidi6 con ron el cielo y la Tierra. . . AI estudiar estas relaciones ocultas, podemos descubnr la Ia inauguraci6n de una exhibici6n de los restos mas completos fuerza del mensaje original del autor. Cualquier estudio serio que se han encontrado de un Tiranosauro rex, al que se apod6 Sue. Ambas exhibiciones estaban en el mismo museo, a unos dellenguaje debe tomar en cuenta los diversos niveles, 0 est~a­ tos de significado que esta detras de los simbolos de cualquler metros de distancia. AI acercarnos a la oficina de boletos, se confirmaron nuestras sospechas, pues la mayoria de las perso- idioma. nas se dirigian a la exhibici6n de Sue. A un lado de la sala El descubrimiento 113 112 El C6digo de Dios en ese momenta estaban a unos cendmetros de mi cara el principal, se estaban formando grupos mas pequenos a los que olvida~o escriba habia desafiado los limites del tiempo. En'un se permitiria acceso a los manuscritos a intervalos cronome- breve Instante, entendi ellenguaje como nunca 10 habia en- trados para controlar la cantidad de personas que iba entran- tendido ni 10 he vuelto a entender. Mas aHa de un conoci- do. iLlegamos justo a tiempo para formar parte del ultimo miento l6gico, de hecho podia sentir que los simbolos formaban grupo del dial un puente entre el pasado yel presente, gracias al poder de las Caminando a 10 largo de una exhibici6n especialmente di- letras hebreas. senada, pude sentir que mi expectaci6n se intensificaba, al igual Durante mas de tres milenios, las letras del alfabeto hebreo que la emoci6n de las personas ami alrededor. AI entrar a la han tenido un lugar unico en el estudio de los lenguajes sagra- sala, escuche expresiones de asombro de mis companeros visi- . d~s. Aun~ue .otras formas de escritura antigua como los jero- tantes. Para minimizar los efectos daninos del calor de las luces, . ghficos egipclOs y la escritura cuneiforme de los sumerios son los bulbos que iluminaban cada fragmento de los manuscritos ' miles de anos mas antiguos, ya no se usan en la actualidad. Es tenian cron6metros que intensificab~n y disminuian la luz des- muy posible que en nuestras interpretaciones modernas de es- pues de cierto periodo. Cada exhibidor con uno de los delica- tas l~nguas,. aunque en general las comprendamos, hayamos dos fragmentos tenia un cron6metro diferente, 10 que creaba i perdido sUtllezas que s6lo podrian conocerse con el uso del un efecto misterioso, pues porciones de la sala cambiaban de ' lenguaje. Esto no ocurre con el alfabeto hebreo; se ha utilizado luz a oscuridad en forma alterna. De inmediato me send atrai-' continuamente durante tres mil anos, y quizas mas. do hacia un pequeno trozo de pergamino grisaceo en un exhi- Aunque con el paso del tiempo han ocurrido cambios en el bidor individual, cerca del centro de la sala. AI estar de pie; significado y usa de algunas letras, sabemos con certeza que frente a el, (era parte del antiguo Libro de Enoch) note que una! el alfabeto ha permanecido igual durante al menos los ultimos ola de calor Henaba mi cuerpo al darme cuenta de la magnitud mil anos. U,na de las versiones mas antiguas del Antiguo Testa- de 10 que estaba contemplando. mento escnto en hebreo, el GJdigo de Leningrado, se escribi6 Ahi, en un trozo maltratado de piel de animal, iestaban las , en el ~no 1008 de nuestra era. Cuando se compara este ma- letras de un mensaje creado por la mana de otro ser humano , nuscnto con las versiones modernas de la misma Biblia, los hada mas de dos milenios! Casi 200 anos antes de que JesUs textos son identicos; iletra por letra! Debido al periodo duran- caminara por esta tierra, un escriba desconocido habia dedica- te el cual se ha utilizado el lenguaje y a la estabilidad de su do tiempo a registrar palabras de sabiduria que ya eran anti- alfabeto, cuando traducimos las palabras del antiguo docu- guas cuando el las escribi6. Las marcas de tinta negra que ~ento hebreo, podemos confiar en que sabemos con preci- formaban cada una de las letras de proporci6n perfecta toda- s16n 10 que el autor trat6 de transmitir cuando se escribieron via se aferraban a la superficie del pergamino, precisamente estas palabras hace miles de anos. como la mano las habia aplicado hada tanto tiempo. Incluso quienes no leen hebreo dicen que tienen una sen- Durante una fracci6n de segundo los siglos que nos sepa- saci6n de santidad, temor reverente y misterio en la presencia raban se desvanecieron. A traves del misterio de las letras, que 114 El C6digo de Dios El descubrirniento 115 de estas letras. Aunque muchos idiomas tiene~ valores nume-, fusi6n de influencias griegas y latinas, tiene un significado mas ricos ocultos en cada letra de sus alfabetos, quizas ninguno de .~ profundo debido a las claves relacionadas con los alfabetos de estos sistemas numericos se haya documentado tan extensa- donde se deriva. 4 mente ni se haya aplicado con tanta frecuencia como el anti- . Entre las multiples formas en que podemos definir a la guo hebreo. "ciencia" hoy en dia, el diccionario ingles American Heritage El Sepher Yetzirah atribuye un poder enorme a las fuerzas i sugiere que "cualquier actividad, disciplina 0 estudio metodo- del alfabeto hebreo, y afirma que a partir de la forma de las, 16gico"5 es una ciencia. Tomando en cuenta esta definici6n letras en si Dios "describi6 todo 10 que se form6 y todo 10 que, ampliamente aceptada, el estudio de la gematria puede consi- se formaria". 3 Desde el punto de vista de la historia, los erudi-: derarse una ciencia antigua, pues tiene resultados precisos que tos han considerado esta afirmaci6n como una metafora que:' pueden repetirse a partir de operaciones espedficas entre le- simboliza el poder de Dios como la fuente de la creaci6n. Como; tras, frases 'f palabras. 6 Como los textos hebreos de la antigiie- vimos en el capitulo anterior, las correlaci<;mes entre los ele~; dad son la Fuente de los conceptos clave que se presentan en mentos quimicos y el lenguaje maS antiguo que se conoce y, este libro, exploraremos la ciencia de la gematria desde la pers- que se ha utilizado mas continuamente, ofrecen una perspec-' pectiva de las palabras hebreas. Tal vez al final descubriremos tiva poderosa de esta afirmaci6n, y tal vez de los origenes de la., que estas rdaciones resuelven el misterio de las fuerzas sutiles e vida misma. En su totalidad, el texto en clave describe coJ invisibles que desafian a la ciencia actual, como los campos precisi6n c6mo y por quien fue creada nuestra especie. morfogenicos y los efectos cuanticos. 7 La ciencia de las letras como numeros Breve intToducci6n al alfabeto hebreo Aunque la raz6n original del significado oculto de una letra en Ellenguaje hebreo es un lenguaje de consonantes. No se escri- particular es en si un misterio, a partir de las inscripciones mas be como se pronuncia y por 10 general las vocales se omiten antiguas de la escritura cuneiforme de los sumerios hasta 101 Jel texto por completo. Hist6ricamente, las vocales que for- lenguajes actuales, cada letra de cada alfabeto siempre tiene u,,' man las palabras que pueden pronunciarse se implicaban en la vinculo con un valor numtrico muy especfjico. El estudio de es-' forma en que se usaban las palabras, 10 que hace que la traduc- tas relaciones se conoce hist6ricamente como gematria. A tra- ci6n de pasajes de la Biblia escritos en el hebreo sea un arte, y yeS de la correspondencia entre las letras y los numeros, la al mismo tiempo una ciencia. Debido a esta peculiaridad, es gematria revela las relaciones ocultas y los niveles de significa- lltit conocer el contexto de 10 que se escribi6 antes de traducir- do mas profundos que normalmente se pasarian por alto aI 10, con el bn de asignar a cada palabra el significado apro- simplemente leer las palabras en S1. Aunque este terna rebasa piado. el ambito de este libro, vale la pena hacer notar que incluso el En epocas mas recientes, las vocales del alfabeto hebreo se alfabeto ingles que es relativamente reciente, y contiene una inrrodujeron a su forma escrita utilizando PUlltOS y simbolos - - ---~-------- ------"" 116 El C6digo de Dios El descubrimiento 117 que se ponen debajo de ciertas letras en una .palabra. Estos simbolos, conocidos como puntos vocdlicos, se usan en la ac- ~ tualidad para garantizar la pronunciaci6n correcta y por 10 tanto el significado adecuado de cada letra y palabra. El alfabeto hebreo primario consta de 22letras, y a cada letra se Ie asigna un sonido y un numero en particular. Asi, se da allenguaje el poder de un significado externo obvio y el de un significado interno oculto. La primera letra del alfabeto, Alef(N), se relaciona con el .: numero 1; la segunda letra, Bet (~), con el numero 2 y as£ } sucesivamente, hasta lIegar a la letra Yod (~) y al numero 10., Despues la secuencia continua en mUltiplos d~ 10, Yla siguientei letra, Kaf('~) tiene el valor numerico de 20; Lamed (~) el valor!i numerico de 30, y asi sucesivamente hasta lIegar a la letra KUf, ~') yal numero 100. A partir de alii, el alfabeto hebreo prima- Figura 5.1: Letras primarias del conjunto de letras hebreas que muestran rio continua con multiplos de 100, Y termina con la letra Tau; el valor numerico "oculto" que se relaciona con cada letra. (ii), que tiene el valor de 400. No obstante, en tradiciones mas antiguas de la Cabala, e1 Casi a mvel universal, nuestras creencias mas preciadas su- alfabeto se extiende aun mas con incrementos adicionales de , gieren que el alma que esta en el interior de cada uno de noso- 100 hasta lIegar al 1000, que se representa con una versi6ni tras sigue ,iviendo despues de la muerte, cuando regresa a los mas grande de la primera letra del alfabeto, Alef (conocida ' reinos que son su origen, ellugar que conocemos como el cie- como "Gran Alef"). Este conjunto adicional de letras es de 10. Por tradici6n, esta relaci6n s6lo se implica a traves de escri- especial importancia cuando se explora el significado mas pro- tos religiosos yespirituales. Sin embargo, al revelarse el vinculo fundo de los textos hebreos. La Figura 5.1 ilustra las letras del directo que existe entre las palabras como valores numericos, alfabeto hebreo primario y los valores numericos ocultos que se descubre esta relaci6n en forma espedfica y grifica. El si- se relacionan con elIas hist6ricamente. guiente anilisis tornado de la obra de uno de los eruditos he- breos mas reconocidos de nuestro tiempo, el Rabino Benjamin El significado oculto del alma y del cielo Blech, ofrece una comprensi6n sin precedente y quizas un con- suelo que nos es muy necesario en relaci6n con el misterio La mejor forma de ilustrar la profundidad de los significados entre el cido, la Tierra y el alma humana.8 ocultos de las palabras es usar un ejemplo, como las palabras La palabra hebrea para alma es "NeShaMaH", que se escri- hebreas para alma y cielo, y su relaci6n con la vida y la muerte. be sin las vocales como N, Jh, My H Al asignarles los d>digos 118 El C6digo de Dios El descubrimiento 119 numericos que se presentaron en la seccion anterior, tenemos "' en cuanto a su naturaleza. Sin tomar en cuenta el significado 10 siguiente: que una cultura 0 sociedad les haya asignado, la relacion nu- merica va directamente al verdadero significado que esta de- N Sh M H eras de las letras. Tal relacion se demuestra claramente con las 50 300 40 5 palabras alma y cielo. jMas aHa de una obvia similitud casual, sus valores numericos son identicos! Por 10 tanto, segun la ge- La suma de estos valores individuales produce un nuevQ matria, el cielo y el alma son 10 mismo. valor combinado de 395. Como sugieren muchas descripciones religiosas tradicio- nales denuestros origenes, "Dios creo el cielo y la Tierra" como 50 + 300 + 40 + 5 = 395 dos ambitos de experiencia distintos pero relacionados. Los textos describen a la humanidad como un puente entre estos En terminos numericos, 395 es "alma", y este numero no~< dos ambitos, un matrimonio entre el cielo (el espfritu 0 alma) permite explorar una relacion que no es obvia en la forma al.. y la Tierra. fabetica de las palabras. Para comprender con precision como d:' reino de los cielos se relaciona con el 395 del alma, aplicamos, ''La humanidad une en sf las cualidades celestiales el mismo proceso a los valores numericos de la palabra cielo. y terrenales... Yo [Dios} creare En hebreo, cielo se escribe Ha-ShaMaYiM. Solo con l~i al hombre para que sea fa union de ambas... "9 consonantes, la palabra se escribe asf: ' A 10 largo de nuestra vida, las cualidades de ambos ambi- H Sh M Y M tos se mezclan en una sola existencia. Y al final de nuestra 300 40 10 40 vida, el cielo y la Tierra que se han unido en nuestro cuerpo, 5 regresan a sus respectivas moradas. Nuestros cuerpos regresan AI representar cada letra con su valor numerico, descubri-, al polvo de la tierra, mientras que nuestras almas y el cielo ya mos una relacion directa y tal vez sorprendente entre las dos son uno. Esta perspectiva de la vida y la rnuerte ofrece un sen- palabras: tido tangible de por que la experiencia de la muerte no signifi- ca el final de nuestra existencia. El codigo numerico Qculto . 5 + 300 + 40 + 10 + 40 = 395 nos 10 asegura. AI sumar los numeros de la palabra cielo tenemos 395; , Los numeros: e[ lenguaje de la creaci6n jexactamente el mismo valor numlrico que tiene la palabra alma! Una de las reglas de la ciencia de la gematria es que dos En su historica obra, Republica, el filosofo griego Platon decla- palabras relacionadas numericamence tambien se relacionan ro que la realidad de nuestro mundo s610 puede conocerse 120 El C6digo de Dios El descubrimiento 121 verdaderamente a traves de nuestra experiencia;. un intento pot AI reconocer este vinculo directo entre las letras de la Tora describir la vida a traves del lenguaje es, en el mejor de 10 \' 11 uestro mundo, la tarea ya de por si ardua de transcribir el casos, una abstraccion. Sin embargo, Platon sugiere que cuan lexto, implica tambien una enorme responsabilidad. Se dice do describimos nuestro mundo a traves dellenguaje, la man'~ que si un escriba comete un error en una palabra, podria alte- ra de hacerlo es usando numeros: "Los geometras utili . I.lr de manera irrevocable el curso de la historia humana por formas visibles y hablan de elias.... Lo que buscan en realida 'icmpre. Debido ala responsabilidad de conservar esa precision, es ver aquelias realidades que solo se pueden ver en la men ("I error de una sola letra al transcribir los textos, se considera- te."IO Pitcigoras, cuyo trabajo anterior tuvo gran influencia e ~ h;\ intolerable. Un error de esta categoria podria causar la des- Platon, tambien describio esta importantisima relacion ent Il'llccion de toda una seccion de un manuscrito cuya creacion los numeros y el mundo de manera simple y concisa: "To posiblemente requirio meses. Por tanto, solo se pasaron a las esta dispuesto de acuerdo a numeros."II gcneraciones futuras copias exactas de "£1 Libro" (la Tora). La importancia de los numeros en el 9.1fabeto hebreo Gracias a la fiabilidad de los textos hebreos y a los secretos innegable. A cada letra del idioma se Ie asigna un valor unie ("scritos en clave en sus letras, ahora podemos comprender como la Tora en su totalidad puede verse como una vasta colecci6 llunca antes nuestra relacion con el mundo y nuestra relacion de numeros. Hoy en dia, tanto los cientificos como los hist': III II tua. riadores creen que cuando la Tora se revelo por primera vez ' la humanidad, se entrego en la forma tradicional dellenguaje El poder de comparar como una serie ininterrumpida de 304,805 caracteres, sin pr 'I "manzanas con manzanas/l nunciacion ni vocales. 12 £1 erudito del siglo XVIII conocid , como el Genio de Vilna, declaro: "Todo 10 que era, es, y se' A traves de la ciencia del lenguaje y de los numeros, hemos hasta el fin de los tiempos esta incluido en la Tora, desdel. cilcontrado un poderoso vinculo entre las letras de las palabras primera palabra hasta la ultima". hcbreas y las ideas que transmiten las palabras. ~Seria posible Se dice que en este codigo numerico se nos dio el mensa' qlIe de manera similar, exista una relacion oculta entre los ori- de nuestro pasado, al igual que las claves para nuestro futur~; genes de la vida que se describen en los textos hebreos y el Si esta descripcion original de la Tora es correcta, jentonces I ll'1lguaje contemporaneo de la ciencia actual? ~Seria posible misterios mas profundos relacionados con la curacion, la paz .., que el abismo que se cree existe entre las explicaciones religio- nuestros origenes, se nos revelaron como una serie ininterrum- ,.IS y cientificas sobre la vida y el Principio sean s610 diferen- pida de numeros! Aunque tal vez fa forma precisa en que esta, lias que se basan en lenguajes de diferentes epocas que describen informacion esta codificada en los libros relativamente breves cxactamente los mismos sucesos? de la Tora no sea muy clara, 10 que si es claro es que los erudi- La clave para tender un puente entre la ciencia y la espiri- tos encuentran en sus paginas un significado que va mucho lualidad, 0 cualquier forma aparentemente distinta de cono- mas alia del mensaje obvio de la palabra escrita. l cr el mundo, es que todos los puntos de vista deben traducirse 122 El C6digo de Dios El descubrimiento 123 al mismo lenguaje antes de poderlos comparar razonablemen- cambio en nombre en 1997), son tan escasos que solo apare- teo Por ejemplo" si preguntaramos: "~Que es mas largo, una cen en condiciones de laboratorio y existen unos cuantos se- milla 0 7920 pies?", ambas medidas deben convertirse a uni- gundos antes de desintegrarse para formar parte de materiales dades del mismo tipo para hacer una comparacion significati- mas estables. va. AI hacerlo, creamos un comun denominador que nos permite Cada uno de los 118 elementos se dasifica seglin caracte- comparar " manzanas . con manzanas» « y no manzanas con na- dsticas que 10 distinguen de otros; propiedades que se descri- ranjas". AI transformar la medida de una milla a 5280 pies, es ben con nlimeros, y se presentan mediante una tabla. Esta tabla facil comparar las dos cifras y responder la pregunta. Es obvio se conoce como La Tabla Periodica de los Elementos, 0 simple- que 7920 pies es mas que una milIa. mente Tabla PeriOdica (ver el Apendice B), y sigue creciendo a De manera similar, encontrar un comlin denominador en-, medida que se descubren elementos adicionales. Al distribuir tre los lenguajes de la espiritualidad y de la ciencia dada un1 y organizar estas caracteristicas, los cientificos determinan don- nuevo significado a algunas de nue~tras tradiciones mas an- ' de "encaja" cada elemento en la tabla. Estas cualidades expresa- tiguas y mas profundamente reverenciadas. Hacerlo, ofreceda das numericamente son el vinculo entre los elementos y nuestro el puente que tanto se ha buscado entre 10 que muchos con- .' ADN con las letras del alfabeto hebreo. Esta dave nos permite sideran los mundos incompatibles de la ciencia y la espiri- leer el mensaje antiguo que aparece codificado como el ADN tualidad. La dave para descubrir ese puente es encontrar un . de nuestras celulas. vinculo comlin que una estos dos mundos. El codigo numeriCa, Entre las muchas posibles caractedsticas que describen cada oculto que estd detrds dellenguaje hebreo ofrece precisamente ese elemento, mi estudio a 10 largo de doce afios revela que solo vinculo. uno destaca como un puente entre los cuatro elementos de la vida y el alfabeto hebreo: la cualidad conocida como masa atO- mica. 13 Aunque su nombre parece muy tecnico, la idea de la El descubrimiento: del alfabeto a los elementos "masa" es un concepto simple que nos dice con que facilidad A finales del siglo XX, la composicion de codo 10 que se podria permlte. 1a matena . que se 1e mueva. 14 Para 1os propositos de imaginar en el mundo fisico se ha reducido a aproximadamente este libro, vamos a referirnos a la masa atomica simplemente 118 elementos. Desde los gases invisibles que forman nuestra como masa, y vamos a considerarla el comun denominador que atmosfera, hasta los densos minerales que forman la Tierra, nos permite tender un puente entre las letras hebreas y los elemen- muchos de los elementos tienen nombres familiares, y han te- tos qulmicos de la creacion. 15 nido papeles importantes en la historia de nuestro mundo. Algo emocionante y maravilloso empieza a desenvolverse Por ejemplo, la fiebre de oro en California, Nuevo Mexico y a medida que vemos los relatos mas antiguos de la creacion a Colorado, contribuyo al desarrollo del oeste americano du- craves de la lente de estos terminos modernos. De pronto, las rante el siglo XIX. Otros elementos, como el elemento 105, referencias esotericas sobre el Principio asumen un nuevo sig- dubnium (que originalmente se llam6 Nielsbohrium, y se Ie nificado profundo. Antes, en el Capitulo 4, descubrimos que 124 El C6digo de Dios El descubrirniento 125 las referencias a los elementos alquimicos de.la creaci6n: elf fuego, el aire y agua, eran en realidad descripciones de los ele"" i mentos quimicos que hacen posible al fuego, al aire y al agua:! el hidr6geno, el nitr6geno yel oxigeno. Para revelar el secreto:: que contienen estos tres elementos en la literatura antigua, < debemos ahora determinar que letras del alfabeto hebreo re~i\ presentan. Aqui es donde el comun denominador de la mas~; !'il-,rura 5.2: El valor de la "masa" nos da otra forma de pensar en los anti- entra en acci6n. AI aplicar los mismos procesos que nos mos";;{ .1~tlOS elementos de "Fuego", ''Aile'' y ''Agua''. Este valor es 10 que llega a ser traron el significado oculto que comparten las palabras "alma"':i (.J comun denominador que une los conceptos antiguos con los elemen- y "cielo", revelaremos el vinculo entre el hidr6geno, el nitr6ge-4 t ( )S modernos. no y el oxigeno y el alfabeto. Siguiendo los principios de la gematria -que nos permiteri: de las cuales se form6 todo 10 demas, se seleccionaron tres le- simplificar los numeros a un solo digito, encontramos que la t ras y se les dio un lugar de honor y respeto que no se compara masa del hidr6geno, 1.007, no necesita simplificaci6n, puef,' con el de ninguna otra letra del alfabeto. Ademas de ser 1a ya esta representada por el numero 1. El mismo proceso revelaJ: "materia" con la que esta hecho nuestro mundo, estas letras se que la masa simple del nitr6geno, 14.00 y la del oxigeno, 15.99,( convertirian en el fundamento del nombre de Dios: el mismo se pueden encontrar sumando los numeros enteros ala izquier-· llombre con el que se conoceria a Dios en la Tierra. da del punto decimal al numero de masa tornado de la Tabla<, · PenG lca. ' d · 1 : "Eligio tres letras de entre las elementales De manera espedfica, el valor del nitr6geno, "14" se con- . [en eI misterio de las tres madres Alif J.,1em Shin] vierte en la masa simple de "5" (l + 4 =: 5). Para el oxigeno, el., y las puso en su gran nombre... ,,16 valor se calcula como "6" (l + 5 = 6). La Figura 5.2 resume: estos valores. Esta f6rmula nos presenta una forma nueva para Al combinar las tres Letras Madres, Dios "sell6" y defini6 pensar en el fuego, el aire y el agua. Establece un comun deno-' ; L't espacio de su creaci6n. Como las letras en si ya se habian minador que nos permite buscar correspondencias para los revelado en el texto externo, la respuesta a nuestra pregunta valores numericos ocultos de las letras hebreas. sobre el significado oculto ahora se vuelve un asunto de co- rrespondencias. Podriamos expresar esta pregunta en la forma familiar de una prueba de l6gica: El secrete de las Tres Madres Si Como dijimos en el Capitulo 4, el Sepher Yetzirah declara que, despues de la formaci6n de las 22 letras de la creaci6n a partir las tres letras Madrcs, A, M, Sh fucron crcadas primcro, 126 El C6digo de Dios El descubrimiento 127 y lila de que algo existiera antes del momento de la gran explo- \ion, para los estudiosos de la Cabala, la existencia de un uni- si estas letras son en realidad la "Madre" de la creacion, . verso anterior al tiempo es un hecho que incluso se necesita para comprender las ensefianzas. y La Cabala describe este "tiempo antes del tiempo y el or- si Y, H, y V son las letras del nombre de Dios (YHVH) . den" como el Universo del Caos, 0 Tohu. En el Caos nacieron y la fuente de toda creacion, las letras Ale[, Mem y Shin y ahi fue donde se explicaron por primera vez. En este mundo sin orden, los elementos, 0 reci- entonces pientes, que exisdan antes de los diez Sefirot no podian inte- ractuar, 10 que hada imposible que experimentaran la esencia mediante un proceso que no es visible externamente, rnisma de la vida; no podian dar ni recibir. Debido a esta con- jA, M, Sh deben convertirse et: Y, H, V! dici6n, eran incapaces de sostener la luz que Dios daba, y su experiencia era incompleta. La relaeion que permite la evolueion de A M Sh hacia Y H V A causa de esta condicion, se hicieron pedazos, 10 que es considera tan sagrada en las tradiciones antiguas, que toda un lin acto conocido como la Rotura de los Recipientes. Como por- seccion del Sepher Yetzirah describe el secreto de ese vinculo.. (jones de estos recipientes rotos cayeron en los reinos espiri- ruales, fueron reconstruidos como recipientes nuevos que podfan "Las Tres Madres, Ale[Mem Shin, un gran dar y recibir. Estos recipientes llegaron a ser los diez Sefirot secreta mistico cubierto y sellado con seis anillos. que forman el Arbol de la Vida para nuestro mundo, el Uni- Y de elias emanaron el aire, el agua y elfUego. IJerso de La Rectificacion, 0 el Orden. Y de elias nacieron los Padres En el Universo del Orden, se dio nuevo significado a las Y de tOS 1 Padres, sus uescen J d'tentes."17 letras hebreas del Caos, y nuestro misterio empieza a tener sentido. El "gran secreto mistico" del Sepher Yetzirah es que las La respuesta a nuestro misterio podria expresarse en un' letras del nombre de Dios (YHV) y las Letras Madres del Uni- solo enunciado: Los eruditos de la Cabala afirman que las trq verso del Caos (AMSh) son iguales. Representan la misma fuer- letras del nombre de Dios (YHV) de hecho se derivan de las. I.a que se manifiesta en diferentes ambitos. En otras palabras, tres Letras Madres (AMSh) y corresponden a elIas. 18 El signifi- Yod, Hey Y lIav vienen de sus contrapartes Ale[, Mem y Shin, l cado que respalda a esta respuesta, no obstante, podria lIenar respectivamente. Teniendo en cuenta estas relaciones, ahora volumenes. tenemos la informacion necesaria para responder a la pregun- En la Cabala, se hace una distincion entre la creacion dd ta sobre como las tres Letras Madres de los relatos hebreos Universo de Orden y el universo anterioral nuestro, el Univer- sabre la creacion se comparan con los elementos de la ciencia so del Caos. Aunque los flsicos modernos luchan con el dile- rnoderna. E1 C6digo de Dios El descubrimiento 129 128 Letras Madres en el En el alfabeto hebreo, hay exactamente tres letras, y solo tres, Letras Madres en el MundQ del Caos Mundo del Orden cuyos codigos numericos ocultos corresponden exactamente a la masa y simple de los antiguos elementos de la creacion. Se ha descubierto A M H que el valor oculto de las letras hebreas Y, H y V se transforma V en los numeros 1, 5 y 6, respectivamente, (ver la Figura 5.3).19 Sh A traves de estas sencillas relaciones de la naturaleza "entre Repasando 10 que sabemos: una manzana y otra", podemos ahora reemplazar los elemen- tos del ADN humano con los elementos correspondientes del 1. El fuego, el aire y el agua son los equivalentes antiguos de ,( alfabeto hebreo. Con s610 ver como corresponden las cifras de hidr6geno, nitr6geno y oxigeno. ' la tabla, es posible vincular directamente las antiguas letras del 2. El puente entre las letras y los elementos son los numeros~, alfabeto hebreo con los elementos de la ciencia moderna. Esta 3. Hidr6geno, nitr6geno y oxigeno tiene!}, respectivament i relaci6n concreta que es posible verificar nos dice mucho so- los valores numericos de 1, 5 y"6. bre los conocimientos de nuestros antepasados. A partir de documentos como el Sepher Yetzirah, ahora com- iUn analisis del c6digo numerico oculto de las letras he;/ prendemos el hecho de que los eruditos anteriores ala Biblia J breas nos revela que no s6lo existe una relaci6n entre las letra , registraran sus conocimientos sobre los secretos de la creaci6n y los elementos, sino que la relaci6n es tan precisa que no pue' " en un periodo aun mas antiguo. En ellenguaje de su tiempo, ;Ii de n e g a r s e ! ' preservaron la sabiduda relacionada con estos conocimientos de la misma manera en que nosotros 10 hacemos hoy en dia en nuestros libros, para las generaciones que ellos sabian habdan de venir despues de ellos. jMas alla de la teoria y la metafora, esos secretos se recono- cen ahora como los detalles (las combinaciones reales de elemen- tos que hoy en dia se reconocen y verifican en la ciencia) que son responsabIes del proceso de la creaci6n y de la vida misma! Ademas de dar credibilidad a estos relatos, nuestras correlacio- nes proporcionan un lenguaje que nos permite traducir las des- cripciones mas antiguas de la creaci6n con un grado de precisi6n Figura 5.3: Los antiguos elementos de la alquimia, y sus equivalentes que nunca antes habia sido posible. como letras hebreas, muestran que existe un vinculo directo entre los La parte final de nuestro misterio es responder la pregunta cuatro elementos de la vida (hidr6geno, nitr6geno y oxigeno) y las letras relacionada con el origen del cuarto elemento de la vida, el y, H y V que forman el nombre antiguo de Dios (la JJ Sl' lisa tll)S wet's y carbono. Si como sugieren los textos, todo se creo a partir de tl'Ol'mos YIIVII). 130 E1 C6digo de Dios E1 descubrimiento 131 A, M y Sh que se convirtieron en Y, H y V, ent~nces, mediante, clave para comprender nuestra relacion con el mundo y, final- un proceso que aun no se ha revelado, el cuarto elemento de l~ mente, el acto de la creacion en S1. vida tambien debe venir de estas Letras Madres. Como el texto nos jnforma que solo estos tres elementos estaban disponibles para Dios en este momento de la crea- cion, se nos dan opciones analiticas muy claras: Debemos su- Soluci6n al misterio del cuarto elemento mar, multiplicar, dividir 0 restar los valores numericos de esos A 10 largo de la historia de la alquimia, ademas de los tr elementos entre si para crear el cuarto elemento, la Tierra. bloques del fuego, el aire y el agua que ya se han mencionad Ir, Cuando estas opciones se presentan, 10 que se conoce como la el cuarto elemento "oculto" siempre estaba implicito. Era ,. navaja de Occam21 es una manera de elegir cual opcion tiene sustancia de la Tierra, que era tan familiar. En tradiciones m mas posibilidades de damos las respuestas mas claras. A me- recientes, aunque la porcion del codigo relacionado con la Tier nudo limita mejor las posibilidades que el metodo de "intento se revelaba directamente, su origen exacto permanecio ocul y error". Expresado en forma breve, la navaja de Occam mr- para todos excepto para unos cuantos iniciados en el mister': rna que en un mundo ideal, la solucion mas sencilla tiende a de los secretos de la creacion. Para los estudiosos del Seph ; ser la mejor. Eso se aplica a las posibilidades que poddan lle- Yetzirah, la clave de este misterio se revelaba a traves del tex vamos a identificar al cuarto elemento, pues una simple suma en si: revela el valor que resuelve nuestro misterio. A partir de las tres letras que Dios uso para "crear su Uni- "Con estos tres (aliento, fuego y agua) verso", Yod, Hey y Yay, nos quedan sus valores numericos de E't;crev /.1 su morada,,20 . 1, 5 y 6. Combinando estos valores con el mas sencillo de los procesos matematicos, la suma, se produce un nuevo numero Con una simplicidad que es elocuente al igual que pro con propiedades muy distintas a las de los numeros originales: da, se nos dice que la morada del Creador se formo utilizan el numero 12. solo esas tres sustancias. Esto confirma que solos 0 combin , dos, los elementos de fuego, aliento (aire) y agua (hidrogen' Yod Hey Vav nitrogeno y oxigeno) son responsables de toda la creacion q , 1 + 5 + 6 = 12 se convierte en la morada del Creador, el mundo y nuestr cuerpos. Ahora el "12" representa el valor del cuarto elemento, la La clave para resolver el misterio del cuarto elemento e "Tierra". Despues, siguiendo el proceso que ya nos es tan fa- que tenia que brotar de elementos que ya exisdan. Para crear miliar de reducir los numeros de dos digitos a un solo dfgito, nuevo elemento, los tres elementos existentes tenian que into- sllmamos ell + 2 del 12 para producir un nuevo valor, el 3. ractuar de una u otra forma. Esta union, a menudo descrita Finalmente, usamos este valor para buscar en la Tabla Periodi- como el "matrimonio" del fuego, el aire y eI agua. Ilega a ser la ca nuestro e1emento misterioso. 132 El C6digo de Dios El descubrimiento 133 Una breve mirada a la qufmica del cuerpo .humano limitil;r:' Con la revelaci6n de informaci6n tan precisa, debemos aho- rei de inmediato nuestra busqueda a unas cuantas posibilida:'to ra preguntar: ~Que mas dejaron nuestros ancestros que tal vez des. De los 118 elementos cuya existencia se conoce, solo 4 d no hayamos sido capaces de reconocer? En la respuesta a esta ellos representan mas del 99 por ciento del cuerpo humano: pregunta adquiere importancia la ultima porci6n de nuestra hidrogeno, el nitr6geno el oxfgeno y el carbono. 22 El carbon i, tabla. ~Cual es el equivalente del carbono en ellenguaje de las es el unico elemento de este grupo que no se ha tornado e letras hebreas? cuenta. De modo que podemos agilizar nuestra busqueda ex, Siguiendo los procedimientos que hemos aplicado en la minando las propiedades del carbono para ver si "son adecu' Liitima secci6n de este capitulo, se produce un resultado ines- das" como un puente entre la alquimia y la qufmica. perado, pero elocuente. S6lo una letra del alfabeto hebreo tie- El valor de la masa del carbono es 12.00. Aplicando el pr ne el mismo valor numerico que la masa simple del carbono: ceso estandar de simplificar los valores como 1 + 2, e1 nueV' 1'1 cuarta letra, Gimel (), que se representa con la G mayu.scula. valor (masa simple) del carbono es 3. Quiz~s no es una coin •• Desde la perspectiva numerica, Gimel es el "carbono" en las dencia que el 3 del carbono sea d unico valor entre los II' escrituras hebreas, yes la "Tierra" en la alquimia de la antigiie- posibles elementos que corresponde exactamente con el3 q dad. (Ver la Figura 5.4). se produjo al combinar las letras del nombre de Dios: Y, H y (1,5 y 6). Desde la perspectiva del Sepher Yetzirah, esto tiene much mas sentido. Como se nos dice que Dios solo tenia fuego, ai y agua para trabajar, que ahora se reconocen como gases i coloros e inodoros, la sustancia del carbono es el unico eleme .' l- to de la vida que nos da solidez. Sin la presencia de este cuart elemento fisico, jnuestros cuerpos no existirfan! Cuando los antiguos registraron el hecho de que estarn hechos de fuego, agua, aire y tierra, en ellenguaje de su ep estaban diciendo que estamos hechos de hidrogeno, nitro , no, oxfgeno y carbono; precisamente 10 que descubriola cien cia del siglo XX. En una epoca anterior al desarrollo de equi sofisticado para realizar pruebas, microscopios de alto poder.' analisis de materiales y las matematicas de las ecuacion ., Figura 5.4: Al redueir los elementos antiguos, los elementos modernos y 1:1, letras del alfabeto hebreo a su eomun denominador numerieo, los qufmicas, nuestros antepasados revelaron la composici6n elt'mentos alquimieos de la ereaei6n se eonvierten en los elementos mo- nuestros cuerpos, describiendo los bloques con que estan cons,.1 dt'rtlos del ADN, y se tradueen a las letras hebreas YHVG en eada eellila truidas todas las celulas humanas. dt' nuestro ClIt.'rpo, 134 El C6digo de Dios El descubrimiento 135 Este paso final para comprender el significado mas profundo': do consideramos que estas cuatro letras, y solo estas cuatro le- de las antiguas letras hebreas, nos permite ah~ra crear una pri-,! tras, equivalen a los unicos cuatro elementos de la Tabla Peri6- mera clave para resolver el misterio del nombre de Dios en',~ dica que forman el ADN humano! nuestro cuerpo. Al mismo tiempo, no obstante, el vinculo entre Aunque ahora tenemos toda la informaci6n necesaria para los elementos modernos y el alfabeto plantea nuevas preguntasi; leer el c6digo quimico en el interior de cada celula de nuestro sobre los secretos que nos han dejado los relatos antiguos de la cuerpo como el texto de un mensaje, sigue existiendo un mis- creaci6n. ~Por que son tan importantes estas correlaciones? ~Que rerio. ~Precisamente que significa el mensaje? Para resolver ese nos dice el descubrimiento de un mensaje antiguo en nuestro' misterio, debemos profundizar en la controversia del antiguo mundo moderno? Podemos empezar a contestar estas pregun-:- ~ nombre de Dios, y la forma en que se revela en las celulas de la tas examinando que tan grandes son las posibilidades de que vida. este mensaje ocurriera simplemente por casualidad. Como se mencion6 en el Capitulo 5, hay un total de 22\ , I RESUMEN DEL CAPITULO 5 letras en el alfabeto hebreo estandar. Estas letras representan et campo de posibilidades a partir del cual podemos unir letras: • Casi todas las formas de comunicaci6n escrita pue- para crear palabras con significado en el idioma. Asi como la" den clasificarse en una de cuatro formas de simbolos oraci6n depende del orden de las palabras que la componen, el o en una combinaci6n de eIlas: imagenes, signos que mensaje que esta en nuestras celulas depende del orden en que; representan palabras, signos que representan silabas esten sus letras. Esta porci6n espedfica del mensaje de nues'", y conjuntos de simbolos como alfabetos completos. tras celulas, YHVG, consta de 4 de las 22 letras posibles. A, • En su forma original, las letras de muchos alfabetos partir de esta informaci6n, podemos calcular las probabilida-~ estaban tambien relacionadas con valores numericos des de formar al azar, con el alfabeto hebreo, una secuencia de .! precisos. Estos codigos "ocultos" representan un sig- cuatro letras que tenga significado. Estas probabilidades se ex- ' nificado mas profundo que esta detds del mensaje presarian como 22 4; inada menos que 1 en 234,256! que transmiten las palabras en s1. En otras palabras, existe una leve posibilidad de .00042 • Algunos de los relatos mas antiguos y completos so- por ciento (1/224 x 100) de que las letras YHVG se configura- . bre los origenes de la humanidad estan escritos en el ran asi por casualidad. jEsa probabilidad se reduce aun mas a antiguo lenguaje hebreo, un lenguaje que ha cam- .000 16 por ciento cuando tomamos en cuenta el alfabeto he- biado muy poco en los ultimos dos mil anos. breo extendido de 28 letras! Aunque estas no son necesaria- • La clave que une los relatos antiguos de la creaci6n mente probabilidades astron6micas, cuando se combinan con con la ciencia moderna es un comun denominador la traducci6n del mensaje, sugieren elocuentemente que algo numerico que nos permite hacer una comparaci6n mas que la "casualidad" y la "coincidencia" es responsable de ese codigo. jEstas probabilidades se amplifican aun mas cuan- dt: "manzanas con manzanas,) . 136 El C6digo de Dios • Nuevo descubrimiento: de las 17 caracterfsticas que definen a la Tabla Periodica de los Elementos, s6lo una corresponde con precisi6n a los valores numericos ocultos dellenguaje hebreo: la masa atomica, 0 sim- piemente la masa. • AI resolver el misterio del cuarto elemento de la al- quimia y la Cabala, se descubre que la "Tierra" es tambien el cuarto elemento de la vida: el carbono. • Nuevo descubrimiento: AI determinar la masa simple de los elementos del ADN (hidr6geno, nitr6geno oxf- geno y carbono) al interior de nuestro cuerpo, ahora podemos reemplazarlos col?- cuatro letras del alfabe- to hebreo: Yod, Hey, Vav y Gimel, 10 que revela que nuestro ADN puede leerse literalmente como un al- fabeto que puede traducirse y que esta presente en el interior de cada una de nuestra5 celulas. Las proba- bilidades de que estas cuatro letras ocurrieran al azar para crear un mensaje significativo con letras hebreas son 5610 de 1 en 234,256, es decir, una minima pro- babilidad del .00042 por ciento. Capltulo Seis EL CODIGO DENTRO DEL CODIGO: En cada ce[u [a de toda vidal esta e[ nombre de Dios E n presencia de quienes aceptan la idea de un solo Crea- dor, celebramos nuestros mas hermosos sueiios y lamen- lamos nuestras mayores tragedias, yal mismo tiempo nos pre- guntamos c6mo el mismo poder podrfa ser la Fuente de am- bos. AI tratar de entender, yen ocasiones incluso complacer, a lIll Dios que identificamos mediante los fragmentos desgasta- dos por el tiempo de nuestras tradiciones mas queridas, se nos presentan muchas y variadas descripciones de lanaturaleza del ( :reador. Si existe un solo Dios, ~por que existen tantas ideas \obre su naturaleza? ~C6mo podemos justificar el hecho de lkdicar nuestra vida, orar, renunciar a todo, e incluso matar ell llombre de una presencia que es tan misteriosa que quisie- (amos tener sefiales que validcn su existencia? 142 E1 C6digo de Dios E1 c6digo dentro del c6digo 143 presencia, el Unico 0 el Eterno, supera el concepto de genero y el concepto de un nombre directo, y los pueblos de la Tierra , 5610 10 conocen a traves de sus milagros que se manifiestan como la naturaleza y la vida. En el sagrado Bhagavad-Gita de la cosmologla hindu, por ejemplo, el poder de la creacion se expresa como tres facetas dei la misma fuerza: Brahma, el creador; Vishnu, el protector; y Shiva, el destructor. Cada aspecto trabaja en armonla con los otros dos para perpetuar el cicio de la vida y la muerte y garan- tizar la continuidad del cosmos. Este tema de un solo Creador, cuyo nombre se vincula con los sucesos que se manifestaron en un momento del tiempo, se comparte en- muchas tradicio- nes nativas, indlgenas y orientales. Tiene un papel primordial ~i en las antiguas tradiciones hebreas y posteriormente tambien en las cristianas. Quizas la explicacion mas directa de nuestra incapacidad Figura 6.1: Equivalencias entre los Seflrot del Arhol de la Vida y los nOffi- bres de Dim can que se relacionan. 4 para conocer a Dios en su totalidad, se encuentre en las pala- i bras del maestro contemporaneo de la Cabala, Z'ev ben Shi-'j mon Halevi. Con la elocuencia de un verdadero maestro, ' Ie habia pedido que transmitiera un mensaje a los israelitas. 3 resume el misterio de Dios en tres sencillas palabras: "Dios es r Posteriormente, cada Sefirot del Arbol de la Vida se relaciona Dios".2 En su erudita interpretacion de los textos hebreos de 1 con un nombre especifico que indica un atributo de la natura- la antigiiedad, Halevi continua esta explicacion con ejemplosl leza de Dios (ver la Figura 6.1). de la Cabala que ilustran la naturaleza de Dios, a quien es ; Las versiones mas antiguas de la Cabala, se refieren aDios imposible conocer. con el nombre de Ayin Sof, que significa Inftnito 0 Ser Inftni- 5 AI referirse a los diez Sefirot del mlstico Arbol de la Vida, 10. El Sepher Yetzirah se refiere aDios utilizando al menos Halevi describe como reinos enteros de la creacion se pueden (ltroS seis nombres, cada uno es muy diferente y cada uno cla- representar con uno de los muchos nombres mlsticos de Dios. rifica una forma especifica en que elSer Infinito se manifiesta El primer reino, por ejemplo, el Sefirot de Keter, 0 la Corona, en la creaci6n. se relaciona con el nombre EHYEH ASHER EHYEH (SOY Entre los ejemplos de estos nombres tenemos: Yah, el Dios EL QUE SOY), 0 el principio y el fin de la creacion. Este es til' los qircitos, el Dios de Israel, el Dios Viviente, Rry del Univer- precisamente el nombre que Dios Ie dio a Moises cuando elle ro, y hi Shaddai.r. Finalmente, las tradiciones de la Cabala y d hizo esta pregunta: "~Quien dire que me mand6?", pues Dios S{'phi'f ) {'/zimb dcscribcn las mtdriplcs comhinaciones de ulla 144 El C6digo de Dios El c6digo dentro del c6digo 145 , sola fuerza que brota de un solo nombre, y los efeetos de un Dios ofrece las misticas palabras: "EHYEH ASHER EHYEH", poder que no es posible conocer directamente. y continua: "Esto les diras a los israelitas, 'Ehyeh me envi6 a ustedes"'. Con estas palabras empieza el misterio y la contro- Soy e[ que Soy versia que ha continuado desde el momento en que se pro- nunci6 hace mas de 3200 anos. Las antiguas tradiciones hebreas y cristianas registran al me- El debate se crea alrededor de la forma aparentemente gra- nos dos momentos en que se dice que Dios se revelaclaramen- dual en que Dios se revela, y las posibles traducciones de las te mediante un nombre personal. Ambos relatos se preservan palabras que utiliz6. Fundamentando el hecho de compartir en el segundo libro de la Tora, y en el Libro del Exodo del su identidad con Moises, Dios puso la palabra Asher justo en- Antiguo Testamento. Aunque el Quran tambien describe-el tre las dos menciones de Ehyeh. En este caso, asher funciona tema general de estos relatos, incluyendo el hecho de que Moises como una forma espedfica de pronombre, un pronombre refa- recibi6 "La Ley" de manos de Dios en el Monte Sinai, mo- tivo que se refiere a la palabra que 10 precede. La palabra en si mento en que la tradici6n hebrea afiima que se revel6 el nom- es un ejemplo extraordinario del poder dellenguaje hebreo. bre secreta de Dios, al parecer el nombrepersonal de Dios no se Sin cambiar la ortografia, Asher puede significar simulta- revela externamente en la tradici6n islamica. Como veremos , neamente "quien", "que" 0 "el cual". Cada una deestas pala- en el Capitulo 9, sin embargo, los nombres de Dios isldmicos, f bras son una traducci6n exacta, dependiendo de la forma en jud/os y cristianos parecen brotar de fa mismafuente, yal parecer que se usen. En el caso de Dios revelandole su nombre a Moi- son equivalentes al poder mismo de creaci6n. ses, las traducciones que mas se aceptan hist6ricamente han El hecho de que Dios haya revelado su nombre a este mundo utilizado la palabra "que", 10 que equivale a "Ehyeh que Ehyeh". se registra por primera vez en el tercer capitulo del Exodo. En No hay duda de que la palabra hebrea Ehyeh se deriva de I el milagro de la zarza ardiente, el relato se describe como una la raiz "ser" en primera persona del singular. s Pero 10 que no es conversaci6n directa entre Moises y Dios, en la que Dios de- claro es precisamente el tiempo que se intenta transmitir cuando clara que es el mismo Dios que describieron los amepasados se dice el nombre. Algunos comentarios de la Tora sugieren de Moises, el Dios de Abraham, de Isaac y de Jacob, al igual que esta incertidumbre podria llevar a diferentes traducciones, que el Dios del padre de Moises. Despues de pedirle a Moi- cada una correcta dependiendo de la forma en que se use la ses que transmita un mensaje al Fara6n de Egipto, el Exodo palabra. Estas traducciones han tenido estos resultados: "Ehyeh" cuenta que Moises, a su vez, hace una sola pregunta: "Cuan- con el significado de "soy", "sere" 0 "voy a ser". Ademas, el do vaya con los israelitas y les diga 'El Dios de sus padres me hecho de que la palabra aparezca dos veces en la misma ora- ha enviado a vedos', y me pregunten '~c6mo se llama?' ~que les ci6n sugiere que la primera vez podria tener un tiempo distin- voy a decir?"7 to a la segunda. De ser as!, la primera podria ser "soy" y la Segun las versiones mas antiguas de los escritos, Dios Ie segunda "sere". 0 podrfa tener el mismo tiempo en ambos respondi6 a Moises directamente. Empezando en Exodo 3: 14, casos, con el significado de "sere quien sere" 0 "soyel que soy". El C6digo de Dios El c6digo dentro del c6digo 147 146 Asi, las palabras que Dios utiliz6 como prefas;io ala revela- '~ Quiero hacer notar que sigo esta forma convencional a 10 lar- ci6n de su nombre, "Ehyeh-Asher Ehyeh", podrian interpretarse go de esfe libra siempre que incorporo palabras hebreas, aun- de diversas maneras, entre ellas: "SOY (QUIEN, LO QUE, que sus traducciones se lean de izquierda a derecha. LO CUAL) SOY", "SERE (QUIEN, LO QUE, LO CUAL) " Con las letras del nombre de YHVH empezamos aver la SERE", y "VOYA SER (QUIEN, LO QUE, LO CUAL) VOY , confusi6n relacionada precisamente con cua! de los nombres A SER". La traducci6n mas comun en la sagrada escritura es' que se Ie dieron a Moises es en realidad el nombre personal de "SOY AQUELLO QUE SOY". Sugiere que Dios se identifica Dios. Aunque Dios se identific6 inicialmente como "Ehyeh- en primer lugar con sus logros (la Fuente de todo 10 que ha existi- Asher Ehyeh" (SOY AQUELLO QUE SOY), es posible que do, existe y existid.) antes de ofrecerle a Moises su nombrepersonal. YHVH sea una variaci6n antigua del nombre EHYEH. 1O Aun- que los patriarcas anteriores a Moises conodan el nombre de YHVH, durante la epoca del Genesis aparentemente nunca El nombre personal de Dios entendieron que su significado fuera el verdadero nombre del Despues de la revelaci6n inicial de su identidad en el Exodo, la ; Creador. Tora registra la siguiente declaraci6n que clarifica aun mas el, En vista de que se atribuyeron muchos nombres a los di- misterio del nombre personal de Dios: "Les diras esto a los versos aspectos de Dios en el cielo durante la epoca del Gene- israelitas: El Senor, el Dios de sus padres, el Dios de Abraham, sis, originalmente se supuso que el nombre de YHVH era s610 el Dios de Isaac y el Dios de Jacob me ha enviado a ustedes: : otro aspecto del Dios viviente. Durante los siglos que pasaron este sera mi nombre por siempre, este es mi apelativo para la desde los dias de los patriarcas hasta los tiempos de Moises, el eternidad. "9 Por primera vez, se nos ofrece un acceso directo nombre "dificilmente habia sido mas que un apelativo ha- bitual". II al nombre personal que Dios Ie revel6 a Moises. Las traducciones modernas tanto del texto hebreo como ' de los textos cristianos muestran esto en la afirmaci6n de que ' El inenarrable nombre de Dios - I Dios se identific6 como "el SENOR". Versiones mas antiguas del mismo texto, sin embargo, revelan otro nombre dado a: En ellenguaje hebreo se nos da una posible indicaci6n de que Moises originalmente: el nombre mistico, sagrado e imposible ' Dios nunca tuvo la intenci6n de que su nombre se dijera entre de proferir verbalmente: YaHWeH. Siguiendo la costumbre ~I los pueblos de la Tierra. AI referirse a su santo nombre, los convencional de omitir las vocales del antiguo hebreo, el nom- ' eruditos de la Tora sugieren que en las palabras mismas existe bre de Dios se revela como las tres consonantes que quedan de una advertencia inherente sobre su uso. De manera espedfica, su nombre, escrito con cuatro letras: ' (Y) n (H) 1(V) n (H): creen que esto se revela precisamente en la forma en que Dios YHVH. Ie describe su nombre a Moises. Cuando Dios declara que AI leer el idioma hebreo, las letras se leen de derecha a YHVH sera su nombre "por siempre", la palabra hebrea por izquierda, de modo que la palabra YHVH aparece como nr~ =,.;" Jiempre, se escribe y no en su forma habitual =,,.;,, con 148 E1 C6digo de Dios E1 c6digo dentro del c6digo 149 la letra Vav (') en el centro. Los eruditos sugi~ren que la Vav ni6n de la mayoda de los eruditos es que en los dias de Moises, 12 que falta indica que debe entenderse como algo ocultO. Al ' YHVH se pronunciaba "Ya-wei". 16 En la pronunciaci6n, la reflexionar sobre esto, el comentario agrega: "Ningun hombre letra V se sustituy6 con el sonido de W, aunque la W no existe " 13 ' debera pronunciar el Nombre d e acuerd 0 a sus 1etras . en el alfabeto hebreo. Basandose en las dos referencias del exodo, los textos he- Algunas porciones de los Manuscritos del Mar Muerto, breos de la antigiiedad se refirieron a Dios con su nombre pre- como el primer texto de Isaias que se descubri6 en 1947, ofre- ferido, YHVH, aproximadamente 6800 veces (segun algunos: cen evidencia tangible de que la practica de utilizar otra pala- registros, son exactamente 6823 veces). Se erda que este nom- bra 0 simbolo en lugar del nombre de Dios ya se habia bre en particular era tan sagrado, tenia tanto poder y exigia·· establecido en la epoca en que se crearon estos manuscritos, tanta reverencia, que pronunciarlo de manera impropia 0 hace aproximadamente 2200 anos. La Figura 6.2 muestra una mostrarle falta de respeto en cualquier forma era deshonrar a: porci6n de la columnaXXXlII del primer manuscrito de Isaias Dios en la peor manera posible. La Tora eI1 si proporciona un, (l Qisa) , que ilustra la costumbre de poner cuatro puntos en- fundamento biblico para esta creencia, al advertir: "No usaras tre las Hneas como simbolos que representan el sagrado e ine- mal el nombre de YaHWeH tu Dios" .14 Por tradici6n, el Nom-! narrable nombre de Dios. bre s610 10 deda el sumo sacerdote duran~e los servicios en el' templo, entonandolo el Dia de la Expiaci6n. En algun momento entre la destrucci6n del Segundo Tern'! plo de Jerusalen en el ano 70 de nuestra era y la recopilaci6n; del Talmud, una colecci6n de literatura hebrea compilada en.,' tre los siglos IV y V, el nombre con el que Dios se identified: en el Exodo fue reemplazado en los textos por un nombr~ sustituto para evitar que se Ie diera mal uso. Entonces, las 680 1\' ocasiones en que se us6 el nombre de Dios, se cambiaron poi Adonai, que significa Sefior 0 por Ha Shem que significa lit< ralmente "el Nombre". Como el nombre revelado a Moises se registr6 original~ mente en el hebreo biblico sin vocales, en la actualidad n tenemos forma de saber con precisi6n c6mo se deda el nom bre de YHVH. 1S Aunque su pronunciaci6n correcta se preser- v6 mediante la tradici6n oral del Templo, cuando se adopt6 la Figura 6.2: Porci6n del primer manuscrito de Isaias, que muestra cuatro practica de usar otra palabra en lugar del nombre de Dios, d puntos en medio de la pagina, arriba de la segunda oraci6n. que susriru- uso oral del nombre original se perdi6 en el pasado. La opi- }Tn al nombrc de Dios.1 7 [Forograffa de John Trevor. ] 150 EI C6digo de Dios EI c6digo dentro del c6digo 151 En el segundo encuentro de Moises con 10 que los comen- temente. Son porciones incompletas de Manuscritos que son tarios hebreos describen como "la Deidad", Dios se identifica tan pequefias que no pueden vincularse con ningun documento de nuevo, aclarando el malentendido que pudiera haber que- espedfico. No obstante, son parte del extraordinario descubri- dado despues de su primer encuentro. En Exodo 6:2-3, Dios . miento de los Manuscritos del Mar Muerto. En un esfuerzo Ie dice a Moises claramente: "Yo soy YHVH". Despues confir- por crear un registro tan completo como sea posible, estos frag- rna que es el mismo Dios que se apareci6 a los patriarcas de mentos, catalogadoscomo "trozos" por los propios eruditos, Israel y explica por que es posible que ellos no conocieran su ofrecen 10 que podria llegar a ser uno de los hallazgos mas nombre en ese tiempo. significativos de la Biblioteca del Mar Muerto. "Me apared a Abraham, Isaac y Jacob como 'El Shaddai', En uno de los diminutos fragmentos, con cada letra per- pero no me di a conocer ante ellos con mi nombre YHVH." fectamente clara, s610 queda una palabra. Estas letras, que so- En estos casos,los eruditos sugieren que Dios se habia identi- brevivieron a los elementos del tiempo y la naturaleza, ficado ante Jacob, Isaac y Abraham a traves, de un atributo, y preservaron cada linea y cada curva exactamente como su au- no con su nombre personal. Por 10 general se piensa que la tor las escribi6 hace mas de dos mil afios; las letras tienen la expresi6n "El Shaddai" significa "Dios Todopoderoso"18 u' forma inconfundible de una palabra que de inmediato atrae "Omnipotente Todopoderoso". 19 la atenci6n tanto del erudito como del lector casual. Esa unica Por tanto, en sus propias palabras, en dos ocasiones en los palabra es el nombre personal que Dios utiliz6 para describirse registros mas antiguos que forman el fundamento de mas de la ante Moises, la palabra nrfi'l: YHWH (Ver la Figura 6.3). mitad de las religiones del mundo, Dios ofreci6 un nombre muy espedfico con el cual 10 conocerian los pueblos de este mundo a traves del tiempo. Evidencia pasada del nombre mas antiguo de Dios El reciente descubrimiento, traducci6n y publicaci6n de algu- nos de los textos hebreos mas antiguos, ofrece un apoyo adi- cional al argumento de que YHVH es, en realidad, el nombre que fue revelado a Moises hace casi 3500 afios. Ademas de los Figura 6.3: Ampliacion de uno de los registros mas antiguos de MjrT!, el 22,000 fragmentos de papiro, piel de animal y cobre que ori- antiguo nombre de Dios. Esta porcion del texto, el fragmento mimero 66 ginalmente se unieron en 10 que se conoce como la Biblioteca de la Cueva IV, estaba entre los 3000 fragmentos que, aunque son parte de la biblioteca de los Manuscritos del Mar Muerto, no puede vincularse de los Manuscritos del Mar Muerto, existen otros 3000 frag- con ningun manuscrito en particular. 20 (Forograf{a de la Autoridad de mentos que se han catalogado, traducido y compilado recien- Anriguedades de Israel). 152 El C6digo de Dios El c6digo dentro del c6digo 153 En un articulo relacionado con el descubrimiento, Her.., Entre esos relatos esta la historia de Hiram Abif, el princi- shel Shanks, editor de la revista BiblicalArcheology Review, C04 pal arquitecto del Rey Salomon, que fue asesinado, pero fue mento sobre la ironia de encontrar este nombre intacto entr vuelto a la vida con el uso de una sola palabra. Sin embargo, los miles de fragmentos. "~Fue simplemente una coinciden4, dice la leyenda que mientras no pudo recuperarse la palabra cia? ~O es que el nombre se utiliza con tanta frecuencia e t verdadera que tenia ese poder, se utilizo la palabra Mah Hah estos documentos religiosos que era de esperarse que aparecie: Bone como una palabra "clave" que la sustituyera. La verdade- ra a menudo (y sobreviviera)? ~O existe un significado m~ ra palabra de la vida era el inenarrable nombre de Dios: profundo?"21 YHVH."2 Como en todas las leyendas, si no es posible verifi- Antes de escribir El C6digo de Dios, fue necesario estable"', car el relato, el aceptarlo se convierte en un asunto de fe perso- cer tan exactamente como fuera posible el nombre con el qu nal. Sin embargo, tomando en cuenta los poderes de vida y la presencia en el Monte Sinai se identifico ante Moises. Des, creacion que se atribuyen al Nombre, no es sorprendente que pues de doce alios de investigacion y del .descubrimiento d tambien se Ie relacionara con la resurreccion. evidencias que se presentaran mas 'tarde en este capitulo, con La base del misterio relacionado con el nombre de Dios es flo, a pesar de toda duda razonable, y a pesar de las controver . la ortografla, la pronunciacion y la vocalizacion del que mu- sias academicas sobre este hecho, que entre las muchas palabrJ: chos creen que es el nombre mas poderoso y sagrado "bajo el y nombres que se han usado para describir el poder y la preseni Cielo". Ademas de la evidencia arqueologica que sugiere que cia de Dios, sobreviva uno como el nombre personal y prefed... el nombre de YHVH es de hecho el nombre personal del Crea- do con el que Dios se identifico claramente. Ese nombre es el, dor, pueden extraerse mas evidencias a partir de la atencion tetragramaton: YHVH. que se da al nombre en el Sepher, Yetzirah. Como vimos en el primer capitulo, el Sepher Yetzirah ofre- El poder del "nombre" ce una vision amplia del proceso que usa una fuerza suprema, identificada con cinco nombres, para poner en movimiento el A falta de una revelacion personal sobre los secretos de la crea.. ' nacimiento de nuestro universo. En la primera oracion de ese cion, recurrimos a los relatos antiguos de este tipo de encuen- capitulo se nos dice que Dios creo este Universo mediante tres tros, ya nuestras interpretaciones de estos relatos para agregar formas de conocer y transmitir informacion. significado a nuestras vidas y encontrarle sentido a nuestro mundo. EI misterio que rodea al nombre de Dios ha perdura- i do y se ha preservado a traves de los sacerdocios, sectas ocultas "Con 32 caminos misticos de Sabiduria grabados YH, y sociedades secretas de nuestro pasado, y permanece en la YHYH de los Ejercitos, Dios de Israel el Dios Viviente, actualidad. Evidencias adicionales del poder que tiene el nom- el Sbaddai, alto y exaltado, que habita en la eternidad bre de YHVH pueden encontrarse en las leyendas y ritos que y santo es su nombre. El creo su universo con se preservan en las tradiciones de los Masones. r'b . tres II ros, con escrztura. , con numeros y con palab ras.· ".?J 154 EI C6digo de Dios EI c6digo dentro del c6digo 155 Por 10 general, los expertos en el hebreo biblico aceptan Aunque parece haber acuerdos diversos en los comentarios que el primer nombre que se da al Creador en este enunciado, hebreos con respecto al hecho de que YH sea un nombre di- YH, es el antiguo nombre de YHVH. 24 La incertidumbre que vino, desde la perspectiva de la Haggadah y del Sepher Yetzi- rodea a este nombre parece surgir precisamente de la forma en rah, no hay duda de que 10 es. En esta primera declaracion que se deriva el nombre. Tal vez en realidad haya sido la forma clave del Sepher Yetzirah, el texto describe como la presencia original del nombre a partir del cual se expandi6 YHVH. 0' divina, llamada YH, llevo a cabo el acto de la creaci6n utili- tal vez es una forma corta de YHVH, reducida a la esencia de! zando tres tipos de informacion, que se identifican como escri- YH,2s que se traduce como "Eterno" .26 El uso de YH en las' ta, numerica y hablada. escrituras tradicionales puede encontrarse hoy en dia en la ver-, sion restaurada de las Biblias Hebrea y Cristiana. En la Tora,i. El universo a partir de un solo nombre Exodo 15:2, leemos "El Sefior (Yah) es mi fuerza y mi poder. ~ Aunque las versiones inglesas traducen esta referencia a Dio! El Rabino Kaplan interpreta esta porci6n del Sepher Yetzirah como "El sefior", el texto hebreo muestra claramente el nom"'; diciendo que Dios crea su universo con "texto {sepher}, con bre de Dios, Yah, con las letras Yody Hey.27 numeros (sephar) y con comunicacion (sippur)" [el autor afia- En la Haggadah, se nos da 10 que podria ser la indicacion; diolos parentesis]. El rabino explica mas a fondo las sutilezas mas directa de que Yah es el nombre de Dios. Se ptesenta en l<i de estas tres formas de conocer, expandiendo su interpreta- historia del matrimonio de Adan y Eva en el Jardin. El textO: cion de los terminos texto, numero y comunicacion de tal esta escrito de tal manera que deja cierta duda en la mente del'" manera que incluyan calidad, cantidad y comunicacion, res- lector, con respecto al nombre con que se revela Dios en la pectivamente. 29 Tierra, incluso antes de los tiempos de Moises. Despues de su: Despues de la introduccion, el texto describe como "Diez boda, Adan y Eva modificaron sus nombres para reflejar d' Sefirot a nada", se crearon los diez reinos del mistico Arbol de cambio que su union habia producido en su interior. Como se la Vida. A medida que se formaba cada Sefirot dentro del va- describe en el texto, fueron los primeros seres de nuestra raza.' do del universo, trajo a la existencia cualidades espedficas: en incorporar el nombre de Dios a su propio nombre: cualidades que se reflejan en todos los elementos de la vida y la creacion. Debido al resurgimiento del interes en la Cabala, Adan llam6 a su esposa Ishah y el se llam6 Ish, abandonan- existen varios textos excelentes sobre la comprension y aplica- do el nombre de Adan que habfa llevado antes de la crea- cion de su sabiduria eterna al mundo moderno. Para los pro- ci6n de Eva, pues Dios agrego su propio nombre Yah a los positos de este libro, sin embargo, nos concentraremos en las nombres del hombre y de la mujer; Yod a Ish y He a Ishah, porciones del Sepher Yetzirah que llevan directamente al men- para indicar que mientras caminaran por los senderos de saje vital que esta oculto en cada celula de nuestro cuerpo. Dios y observaran sus mandamientos, su nombre los prote- Despues de que los diez Sefirot surgieron del vado, el Se- gerla contra rodo dafio. 28 [Las italicas son del auror]. pher Yetzirah dctalla cl proccso en si con el que Dios lIev6 a 156 El C6digo de Dios El c6digo dentro del c6digo 157 cabo su creaci6n. Con parrafos concisos escritos como prosa, ' E[ ADN: [a "piedra de Rosetta" de [a vida los versos describen conceptos ampHsimos que van desde eL ~n el plan general del cosmos, hemos existido solo muy poco origen del universo hasta la relaci6n de este universo con nues-, tlempo como especie dentro del periodo de vida del planeta. tros cuerpos. En terminos cuyo significado es bastante claro, Recuerdo haber visto, en un libro de texto universitario, la las frases afirman que a traves de estas cuatro letras Dios 'cons- '. cdad del universo yel nacimiento de la raza humana representa- truy6 el universo. dos en la caratula de un reloj para ilustrar los periodos relati- vos en que aparecieron. Cada hora del reloj representaba grandes Las 22 letras; Ellas grabo, las esculpio, las impregno, las peso, periodos de la existencia de la Tierra, solo en los ultimos tres las transformo y a partir de ellas formo todo 10 que alguna vez se ': minutos antes de las 12, habia evidencia de la aparici6n de la formara y todo 10 que alguna vez se forma rd. 30 raza humana. Aunque continua la controversia sobre 10 que ocurriO exac- tamente antes del momenta de la creaci6n y el principio de la El significado es tan claro que sus implicaciones dejan a la;e vida humana, parece que el consenso relacionado con el tiem- mente tambaleante. Dentro de nuestro cuerpo, se producen J po en que apareci6 esra cobrando fuerza. Gracias a nuevas evi- se replican y se guardan, como el milagro de cada celula hu-; dencias que apoyan la teoria de la Gran Explosi6n, se ha mana, las letras que permitieron el nacimiento del universo. calculado que el nacimiento del universo ocurrio hace aproxi- En la segunda mitad del siglo:XX se caracteriz6 a la mole,,: madamente 130 14 cientos de millones de aiios. 31 Dentro de cula de ADN como un "lenguaje". Aunque los antiguos nQ. cste enorme periodo, se calcula que la Tierra se form6 hace tenian palabras modernas para nombrar las celulas y las mo.,; aproximadamente 4.5 cientos de millones de aiios, y que la leculas, en el idioma de su epoca nos invitaron a mirar a "nues~ primera evidencia de nuestra especie apareci6 hace s610 con tro interior" para descubrir el conocimiento de nuestra.' 160,000 aiios. Suponiendo que los dlculos relacionados existencia. Ahora, siglos mas tarde, su sabiduria nos permite' con estos enormes periodos se acerquen siquiera a 10 correeto, hacer que la metafora moderna del ADN como lenguaje, de 1 iya habia transcurrido un 99 por ciento de la vida del planeta un paso mas. ' ,mtes de la aparici6n de nuestros primeros antepasados! Simplemente siguiendo las instrucciones que se han pre- A pesar de la controversia sobre la forma exacta en que se servado desde el pasado, se nos muestra el c6digo que nos per- dio nuestro origen 0 sobre cuanto tiempo hemos estado aqui, mite sustituir los elementos que forman el ADN con letras del· desde el momenta de nuestra aparici6n en la Tierra existe una alfabeto hebreo. AI hacerlo, podemos interpretar el lenguaje sola experiencia que siempre hemos compartido con nuestros de la vida y leer su mensaje. Para comprender c6mo el c6digo antepasados mas antiguos. Durante aproximadamente un cuar- genetico puede traducirse como un lenguaje, sin embargo, to de mi1l6n de afios, el procesode concebir y dar a luz a la debemos primero lograr cierta comprensi6n de la forma en vida humana ha seguido siendo el mismo; hasta la ultima ge- que el ADN trabaja en nuestro cuerpo. IIcraci6n del siglo XX. 158 El C6digo de Dios B c6digo dentro del c6digo 159 iHemos descubierto ell/secreto de la vida"! comprensi6n de la estructura de la doble helice fue 10 que re- solvi6 el misterio del comportamiento genetico que llev6 a En 1978, el vinculo que hemos compartido con los miembros que se les otorgara el premio Nobel en 1962.* mas lejanos de nuestra especie cambi6 con el nacimiento de Como ocurre a menudo, durante momentos informales Louise Joy Brown. El 25 de julio de ese afio, a las 11 :47 de la despues de un intenso periodo de investigaci6n, Francis Crick mafiana, naci6 Louise en un hospital en Gran Bretafia: el pri-' entr6 al Eagle Pub en Cambridge, Inglaterra, e hizo alarde de mer ser humano que pudo concebirse fuera del vientre mater- la magnitud de sus descubrimientos. Como Watson record6 no. Con esto se origin6 la frase bebe de probeta que describe tiempo despues, Crick dedar6 que gracias a sus esfuerzos, se este tipo de concepciones; en esa fecha, el requisito de uni6n habia "descubierto el secreto de la vida", 33 Ese fue el secreto sexual para crear una nueva vida se convirti6 en una opci6n y que llev6 a la tecnologia que hizo posible el nacimiento de dej6 de ser una necesidad. Louise Brown. Las repercusiones eticas del descubrimiento A partir de entonces, mas de 20,000 nifios se han concebi-' de Watson y Crick siguen estando presentes en la actualidad, y do fuera del vientre materno, se les-permite'desarrollarse en un, se reflejan en candentes debates sobre temas como la dona- entorno externo temporalmente y luego se les coloca en el ute- cion humana, la investigaci6n de celulas vastago "stem cells" ro de una mujer que ha sido preparada para llevar y dar a luz ai, [celulas tomadas del cuerpo en una etapa muy temprana de nifio a su debido tiempo. Ademas de re-definir el acto de la', s~ desarrollo y que pueden transformarse en cualquier otro concepci6n y el embarazo, esta linea de exploraci6n ha llevado; upo de celula], y nuestra responsabilidad en las primeras eta- a las milagrosas habilidades que nos permiten seleccionar las" pas de la vida huma:la. caracteristicas de los nifios antes de la concepci6n y alterate, sus caracteristicas despues de la concepci6n. Nos permiten con.... cebir la vida con el fin de cultivar celulas especializadas, e in"":' Se traduce el alfabeto del AD N cubar ciertas celulas para crear tejidos espedficos. Los avances:" Casi desde el momento en que se descubri6 el c6digo de la de tecnologias que parecen tan milagrosas empezaron con la vida, ~os cientificos y quienes no 10 son han descrito el plano publicaci6n de un solo articulo a mediados del siglo XX. . geneuco como un "lenguaje", En una conferencia de prensa En 1953, la revista britanica Nature public6 un articulo de, que se llev6 a cabo en el verano de 2000 sobre temas ciendfi- James Watson y Francis Crick titulado "Estructura molecular, cos, el entonces presidente de Estados Unidos, Bill Clinton, de los acidos nudeicos: Una estructura para el acido nudeico apareci6 junto con los lideres de dos empresas que habian rea- deoxyribrose" ,32 Con la publicaci6n de su articulo, se abri61a puerta para alterar, manipular y construir la esencia misma de la vida: la motecula de ADN. Aunque el trabajo de Watson y • En 1%2, e1 .Premio ~o~e1 de fisiologfa y medicina fue compartido por Crick induia investigaciones de otros dos cient(ficos del King Watson, Cnck y WilkInS por su trabajo en e1 descubrimiento de la estructura del ADN. Rosalind Franklin murio en 1958 y no se Ie nom- College de Londres, Rosalind Franklin y Maurice Wilkins, su bra en eI premio. 160 E1 C6digo de Dios El c6digo dentro del c6digo 161 lizado uno de los esfuerzos de investigaci6n cooperativa mas de vida se establece a partir de la disposici6n de estas cuatro grandes de la historia: El Proyecto sobre el Genoma Humano. bases. Gracias a sus esfuerzos conjuntos, habian producido el primer Mediante un proceso que s6lo se conoce parcialmente, las mapa de nuestro c6digo genetico y habian abierto la puerta a bases se disponen de cierta manera que formen pares, conoci- una nueva era para la ciencia medica y las ciencias relacionadas dos como pares base, y cada par contiene las pautas que se com- con la vida en el siglo XXI. AI describir la importancia de este binan cor. otros pares para formar pIanos de vida. En otras hito, Clinton declar6 que el genoma era el "lenguaje con el palabras, cada base funciona s6lo con un compafiero espedfi- que Dios habia creado la vida".34 . co: la guanina siempre se une a la citosina (G-C) y la adenina A pesar de 10 frecuentes que son este tipo de r~ferencias, siempre se une con la timina (A-T). Los pares se colocan fren- muya menudo se usan s6lo en sentido figurado para describir te a frente formando los peldafios de una estructura similar a los bloques de construcci6n de la vida; ellenguaje del c6digo una escalera en espiral, la ya conocida helice doble 35 (ver la quimico de la vida. A partir de las re~aciones que se han descri- Figura 6.4). Estos pares base conforman el c6digo genetico to ya en este libro, sin embargo, es obvio que el ADN puede \ que se ha dado a conocer ampliamente en afios recientes. ahora considerarse como un lenguaje muy real con un alfabeto El 26 de junio de 2000, el mundo contemp16 asombrado antiguo que es posible traducir. Es ellenguaje que preserva el el anuncio que hicieron dos empresas competidoras, una pri- unico mensaje que trasciende toda diferencia que pudiera lle- vada y otra federal, que habian reunido los recursos para pro- gar a separarnos como familia humana. Para revelar el mensaje ducir el primer mapa sobre la manera en que se disponen las de nuestros cuerpos, debemos entender el mensaje de la vida. bases que forman el ADN humano. AI ilustrar este mapa, se pro- yectaron en las pantallas de televisi6n y en las paginas de revis- La genialidad del descubrimiento de Watson y Crick se basa, tas populares, series interminables de letras. Las secuencias, en su descripci6n de la molecula del ADN en sf. En terminos algunas de las cuales constaban de dentos de letras, represen- comprensibles, los bloques de construcci6n de la vida son sor- taban las bases que habian sido identificadas en diferentes si- prendentemente simples, y al mismo tiempo, agradables a la tios de la molecula del ADN humano. Estas combinaciones se vista. La esencia de la investigaci6n genetica se basa en la com- conocen como genes. Grupos de genes forman los 23 pares de prensi6n de que toda vida esta formada con combinaciones de informacion vital (cromosomas) que nos hacen unicos como cuatro compuestos quimicos. Se trata de las unidades basicas especie. 36 A continuaci6n se presenta una porci6n del cromo- de la vida: adenina, timina, guanina y citosina (A, T, G y C, soma 1 humano para ilustrar el aspecto de este c6digo: respectivamente); se les conoce como las bases del ADN y con- tienen toda la informaci6n que se requiere para producir toda GATCAATGAGGTGGACACCAGAGGCGGGGACTTGTAAATAACACTGGGCTGTAGGAGTGA forma de vida que se conoce. Desde los organismos unicelu- TGGGGTTCACCTCTAATTCTAAGATGGCTAGATAA GCATCTTTCAGGGTTGTGCTTCTA lares mas pequefios, hasta los cien billones de celulas que se TCTAGAAGGTAGAGCTGTGTCGTTCAATAAAAGTCCTCAAGAGGTTG(;TAATA(:GCAT calcula hay en eI cuerpo humano, eI c6digo de cada forma (;rITAATA(;TA<:A(;TA1'( ;(;1'(;A< ·TATA( ;1'( ·AA( :AATAA1'TTA1'T<;TA( :A1'TTTTAAA1'A(; 162 E1 C6digo de Dios El c6digo dentro del c6digo 163 de Dios y los elementos de la ciencia moderna, ahora es posi- ble revelar todo el misterio y el significado mas amplio del antiguo codigo que esta presente en cada celula de nuestro cuerpo. Figura 6.4: Ilustracion de la estructura de la helice doble del ADN, que) muestra como las bases especificas siempre forman pares entre S1: C can Gy A con T. doscientas cuarenta bases forman una porcion del cromosoma 1 humano. La clave para traducir el codigo del ADN a un lenguaje significativo es aplicar el descubrimiento que transforma ele- mentos en letras. En base a sus valores correspondientes, el hidrogeno se transforma en la letra hebrea Yod (Y), el nitroge- no en la letra hebrea Hry (H), el oxigeno en la letra hebrea Vav (V) y el carbono en la letra hebrea Gimel (G). Estas sustitucio- Figura 6,5: Las cuatro bases del ADN; se muestra de que elementos estan liechas yel equivalente de cada uno como una letra hebrea. Como nues- nes revelan ahora que el nombre antiguo de Dios YH existe 'r<) Cf)digo genetico esta formado can combinaciones de las bases del ADN, como la quimica literal de nuestro codigo genetico (las letras 'JlIl' en ocasiones tienen cientos de letras, t:xisten innumerables formas subrayadas en la Fih'Ura 6.5), Con estt' pUt'ntt' entre d nombre ('1\ tllll' las lelras YIIV<; puetlell (( lI11hinarse l'll 1lI1l'stras cl'llilas, 164 E1 C6digo de Dios EI c6digo dentro del c6digo 165 En cada ce[u[a de cada vida Diez Sefirot a Nada: Uno es se reve[a e[ c6dlgo el Aliento del Dios Viviente, Vida de los mundos.... Durante una entrevista, Ie pidieron a Albert Einstein que; Este es el Santo Aliento. "38 describiera como entendia ella naturaleza de Dios. En su res- puesta, menciono el hecho de que aunque no vemos directa- Ademas, los primeros capitulos del Genesis relatan que en mente al creador, cada dia y a cada momento se nos muestrani el momento de la creacion, el Creador estaba presente pero no evidencias de su existencia. . en forma fisica (Genesis 1:2). Era "el espiritu de Dios" [enfasis "Mi comprension de Dios", dijo Einsein, "viene de la pro~ aiiadido por el autor] 10 que se movia sobre la superficie de la Tierra. funda conviecion de que una inteligencia superior se revela e~\ un mundo cognoscible".37 Estas declaraciones llenas de candi~; El Sepher Yetzirah describe ademas como la primera letra dez nos muestran como una de las mentes mas privilegiad~; h~brea s~rge del vado de la creacion como la Letra Madre que del ultimo siglo percibia la inteligencia que esta detras de nues4f hl~O .poslble el universo: Alef. A traves de un gran "secreto" tro mundo. El descubrimiento que vincula a esa inteligenci . mlStlco, Alifevoluciono y se convirtio en el primer elemento con los elementos de la vida da ahora mas significado a la per que :parecio en nuestro universo, el hidrogeno, y tambien en cepcion de Einstein. la pnmera letra del nombre de Dios: Yod. Las teorias moder- Cuando reemplazamos los elementos modernos con las Clla; na.s sobre la Gran Explosion sugieren que el hidrogeno fue el tro letras del nombre antiguo de Dios, vemos un resultado qu' pnm~r elemento que se formo a partir de la energia liberada a primera vista podria ser inesperado. Si reemplazamos la ulti en el mstante de la creacion. jAmbos relatos parecen describir J rna H de YHVH con su equivalente quimico, el nitrogeno, '. el mismo elemento! nombre de Dios se convierte en los elementos de hidrogeno El Exodo nos recuerda en terminos muy espedficos que el nitrogeno, oxigeno y nitrogeno (HNON): jTodos ellos gas nombre de YHVH se revelo como el nombre personal de Dios. incoloros, inodoros e invisibles! En otras palabras, al reempla En terminos igualmente claros, se nos muestra que la humani- zar el cien por ciento del nombre personal de Dios con 10 dad fue creada "a imagen" de Dios. Tal vez en estas afirmacio- elementos de este mundo, ise crea una sustancia que es un!' nes se encuentre la clave mas directa para describir nuestra forma de creacion intangible pero muy real! flI, relaci6n con la Fuente de todo 10 que "existe". Con renovado' De hecho, en las descripciones mas antiguas de Dios, s enfasis, la afirmacion relacionada con nuestros origenes nos nos dice que es omnipresente y que adopta una forma qu~ recuerda que fuimos creados a imagen de Dios, no como Dios nuestro mundo no puede percibir con los ojos. Por tanto, s6lo ni iguales a ~ios. A pesar de ser suril, esta afirmacion sugiere se Ie puede conocer a traves de sus manifestaciones. El Sepher que aunque mdudablemente compartimos los atributos de Yetzirah describe esta forma no-fisica de la presencia de Dios nuestro Creador, tambien se nos distingue de YHVH con algo como el "Aliento" de Dios. que nos hace muy diferentes a E1. 166 El C6digo de Dios El c6digo dentro del c6digo 167 Al sustituir los elementos modernos con ~etras antiguas, es abundante en el universo, El es parte de todo 10 que ha existi- obvio que aunque compartimos las tres primeras letras qu ' do, existe y existira. representan el 75 por ciento del nombre de nuestro Creado~' la cuarta y ultima letra de nuestro nombre quimico nos separa de Dios (ver la Figura 6.6). Aunque la presencia de Dios es 1 El nombre de Dios en el cuerpo del hombre forma invisible e intangible de los tres gases: hidrogeno, nitr' . Cuenta la leyenda que cuando el Rey Salom6n construy6 su geno y oxigeno, la ultima letra de nuestro nombre es el "mate: santo templo en Jerusalen, se llev6 a cabo un antiguo ritual rial" que da color, sabor, textura y sonido a nuestro cuerpo, antes de colocar la primera piedra. Este ritual, preservado hoy el carbono. La unica letra que nos separa de Dios es tambien gracias a las tradiciones de los masones, incluia la orientaci6n elemento que nos hace "reales" en nuestro mundo. y colocaci6n de una piedra, la piedra angular, segun la cual se orientadan todas las demas piedras de ese enorme complejo. Se dice que el rey puso una hoja de pergamino en el interior de la piedra angular en la que el escribi6 un solo nombre. Simb6- licamente, el nombre que sefialaba esta piedra angular del Santo Templo de Jerusalen tambien llegada a ser el nombre en el que el Rey Salom6n basada elliderazgo de su pueblo, el poder de su naci6n, y llegada a ser el fundamento de una tercera parte de las religiones organizadas de la Tierra. Ese unico nombre era el tetragramat6n YHVH, el nombre eterno de Dios. Un analisis aun mas meticuloso de las letras que forman el nombre de Dios yel cuerpo del hombre clarifica precisamente Figura 6.6: La H de YHVH, el nombre de Dios se reemplaza con G 10 que esta relaci6n significa para nosotros hoy en dia. Aunque YHVG el nombre de la humanidad. Esto ilustra que aunque compartt las versiones originales de los textos biblicos reconocen sin lu- mos tres de las cuatro letras del nombre personal de Dios en nuestro codi .: genetico, no somos iguales a Dios; un 25 por ciento de nuestra co, gar a dudas que YHVH es el nombre de Dios, tambien se posicion es diferente. Esta es la diferencia que nos da una constituci6 refieren a la versi6n corta YH, como se mencion6 antes. Por 10 fisica y que explica nuestro canicter unico como especie. general, los eruditos aceptan ambos nombres YHVH y YH , como intercambiables. 39 Cuando se traduce, el nombre YH pue- Esto no indica que Dios sea simplemente un fatuo gas for. de interpretarse como "el Eterno".40 mado con elementos invisibles. Mas bien sefiala que a trave$ Aunque los datos espedficos poddan variar segun los tiem- f del nombre que Dios Ie revelo a Moises hace mas de tres mile- pos y las culturas, en lenguas modernas como el ingles, la pala- nios fueron posibles el mundo y el fundamento de la vida mis- bra eterno implica claramente una existencia que no tiene rna. Dins nos dice que en cl hidn'>gcno, el clcmcnto mas principio ni fin y que opera mas alIa de las limitaciones del 168 El C6digo de Dios El c6digo dentro del c6digo 169 , I tiempo.41 Es precisamente este aspecto "etern.o" 10 que es co) reinos alternos de la creaci6n. Aunque las cualidades relacio- mun tanto en el nombre de Dios YHVH como en el cuerpo nadas con esto varian, el significado en S1 no cambia. De modo humano YHVG, como se indica en las letras subrayadas. Tan- yue al considerar las letras VG 0 GVen el hombre de la huma- to a traves de las letras secretas de la antigliedad como a trave nidad, YI-NG, podemos buscar su significado literal para 10- de la traducci6n literal del ADN como alfabeto, se nos mues grar una mayor comprensi6n. tra: que algo de nuestra existencia permanece y es eterno. Com.. En ellenguaje hebreo, las letras GV significan "dentro", 0 partimos la cualidad interminable de nuestro Creador en un, (1e manera mas" f ilea, espeCl "e1 lntenor . . de1 cuerpo. " 42 E ne tr 1as 50 por ciento de los elementos que definen nuestro c6digQ 231 puertas misteriosas de la creaci6n del Sepher Yetzirah,43 genetico. GV representa aDM, es decir la ra1Z del nombre de Adan, que significa "sangre". Al combinar estas traducciones del mensaje yue esti en nuestras celulas, tenemos una comprensi6n sin YHVH = el nombre de Dios precedente de nuestra relaci6n con la creaci6n a traves del nom- YHVG = el nombre del Hombre bre de Dios. AI reemplazar los elementos del ADN con sus cquivalentes en letras hebreas, revelamos el mensaje que esta YH (Dios/Eterno) forma fa mitad del nombre de Dios cscrito en el interior de cada celula de nuestro cuerpo (ver la y del nombre que aparece como codigo en nuestras etlulas. Figura 6.7b). La promesa de D10S en el cuerpo del hombre El segundo aspecto de nuestro nombre quimico lleva nuest , relaci6n con Dios a un nuevo nivel. Ademas, describe precisa mente como existe Dios en nuestro cuerpo. Las dos ultim . letras (VG) de nuestro nombre en letras hebreas que equivale . al ADN (YHVG), ilustran la naturaleza de esta relaci6n. En I, ciencia eJe la gematria, es importante notar que los c6digos: Figura 6.7a: Los elementos de nuestro ADN traducidos como letras del numericos de los alfabetos antiguos no toman en cuenta e~ ,tlfabeto hebreo. orden de las letras. Asi como 1 + 2 Y 2 + 1 son igual a 3, las reglas de los c6digos de letras permiten las mismas considera- ciones en cuanto a los valores de las letras. • YH: la forma abreviada y aceptada de Ademas, entre los misterios de la Cabala, el orden inverso YHVH/Eterno, el nombre antiguo de Dios. (alterado) de un conjunto de letras a menudo se relaciona con • V(;/(;V: dcntro del CUl·rpO. 170 £1 C6digo de Dios £1 c6digo dentro del c6digo 171 Traducci6n literal que revela el mensaje: mejantes. La Figura 6.8, puede ayudarnos a sacar varias con- clusiones. Figura 6.7b: E1 mensaje que se revela cuando la quimica de nuestras celu~! las se traduce a letras del antiguo hebreo. . AI sustituir estas palabras de nuestro c6digo genetico, p demos ahora ilustrar c6mo el nombre literal de Dios forma eJ mensaje en el interior de nuestros cuerpos: Dios/Eterno del\; r tro del cuerpo. Una ilustraci6n gnifica de esta sustituci6n mue tra que mediante diversas combinaciones de nuestras cuatr bases de ADN: adenina, timina, guanina y cistocina, es posib ' crear la sustancia de la vida a partir del nombre de nuestro cuer' po (ver la Figura 6.8). Es igualmente claro que las bases d c6digo contienen diversos grados de la presencia de Dios " den 1 tro del cuerpo"44. Antes describimos las letras T, C, A y como abreviaturas de las combinaciones de hidr6geno, nitr '," geno, oxigeno y carbona que conforman las bases del AD ' AI reemplazar cada elemento con la letra hebrea equivalent> Figura 6.8: ilustraci6n grafica del nombre antiguo de Dios, YH, en el se nos muestra precisamente c6mo la vida humana se crea' material que forma nuestro c6digo genetico. partir de variadones del nombre de Dios en nuestro cuerpo.; Aunque requieren estudios posteriores, estas correlacion' • Cuando se ve la correlaci6n del c6digo de toda vida abren la puerta a una manera nueva y diferente de ver nuestr' con el alfabeto hebreo, se convierte en un mensaje relaci6n con Dios y con la creaci6n. Es obvio que este tipo d que esta en nuestras celulas y que puede traducirse. proceso representa s6lo el principio de un estudio mas ampli que hani posible una comprensi6n mucho mas profunda. • Diferentes formas de bases de ADN producen el men- Aunque los vinculos entre ellenguaje y los elementos no saje con diversos grados de repetici6n. logran definir quien es el Dios de nuestras plegarias, 0 que • El 50 por ciento del mensaje que esta en el interior aspecto tendria en realidad esa presencia, nos ofrecen una com- de nucstras cClulas sc traduce literalmcnte como prensic'>n sin precedente de nuestro mundo y de nUl'stros sc- "Dios/I ':terno." 172 EI C6digo de Dios EI c6digo dentro del c6digo 173 • ElSa por ciento restante de nuestro c6digo genetico donde se reemplaz6 con nombres sustitutos para evi- se traduce como "en el interior del cuerpo", y por tar que se Ie diera mal uso 0 se Ie deshonrara. tanto describe d6nde podemos encontrar la natura- • La estructura de toda vida consta de diferentes com- leza eterna de Dios en este mundo. binaciones de s6lo cuatro bases de ADN, y cada base consta de los cuatro elementos basicos de la vida: ElIas tradiciones mas preciadas de la humanidad, se no hidr6geno, nitr6geno, oX1geno y carbono. recuerda nuestra relaci6n con un poder superior y la naturale • Nuevo descubrimiento: AI reemplazar los cuatro ele- za imperecedera de esa relaci6n. El descubrimiento del nom mentos de nuestro ADN con las letras que represen- bre de Dios en el interior de cada celula de toda vida revela, tan sus antiguos nlimeros ocultos, se revela que la menos, un mensaje al igual que una promesa, que trasciend, base de toda vida esta formada por diferentes com- cualquier diferencia que podriamos imponernos. En un senti1). binaciones del nombre original de Dios: YH que sig- do muy real, el fundamento de nuestra existencia se forma co nifica "Eterno". una esencia eterna y sin limite. Es esta chispa de la creaci6n 1 • Ademas del nombre en S1, las letras VG, que signifi- que textos como el Sepher Yetzirah equiparan con el Creador; can. "dentro del cuerpo", aparecen como un c6digo una chispa que claramente comparte al menos el 50 por cien~, en el resto de los bloques de construcci6n de la vida. to del nombre que explica nuestra existencia y que contiene 1" • El mensaje es un recordatorio de que la vida humana promesa de que cada uno de nosotros llegara a ser algo qu .;: espedficamente, y toda vida en general, esta unida supera las condiciones y limitaciones de nuestra v i d a . :1. por un legado comlin. Aunque no describe como se Esta es la promesa que comparte todo hombre, mujer, ninGi origin6 ese c6digo en nuestras celulas, el hecho de su y antepasado de nuestra familia global, como un mensaje vi-' existencia y 10 poco probable que seria que ese men- viente escrito como un c6digo en el interior de cada celula d . saje se formara por casualidad, sugiere la presencia nuestro cuerpo. de una inteligencia superior y de una intenci6n rela- cionada con nuestros origenes. RESUMEN DEL CAPITULO 6 • Debido a la- naturaleza infinita de la existencia de Dios, se Ie identifica con nombres que describen sus manifestaciones, como YH (el Eterno)YH YHYH (YH el Senor), El Shaddai, yel Creador. • El nombre de YHVH se consider6 tan sagrado en la tradici6n hebrea que aparece 6800 veces en la Tora, T El sl Como apllc' Capftu[o Siete MENSAJE DEL PRIMER DIA: Como leer el lenguaje de D105 L as reacciones al descubrimiento de los vfnculos que exis- ten entre los alfabetos de la antigliedad y los elementos modernos han sido variadas pero predecibles. Para algunos, la reve1aci6n del nombre de Dios en el interior del c6digo de la vida tiene implicaciones de tal magnitud que se sienten abso- !utamente abrumados. Las respuestas iniciales han sido desde la incredulidad hasta la curiosidad, Uegando al temor reveren- te y al asombro. Siempre hay preguntas y un deseo de saber mas. (Como pudimos pasar por alto algo tan importante du- rante tanto tiempo? Para oeros, el descubrimiento ofrece un bien recibido des- canso, pues confirma a nivel cientIfico 10 que eUos ya sospe- chaban en su coraz6n y experimentaban en la vida. Por encima de las diferencias de la cultura, la raza, la religion, las activida- des 0 las creencias, el mensaje nos recuerda que somos parte de Oligo que rebasa las diferencias que podrlamos imponernos. 180 El C6diga de Dias Mensaje del primer dia 181 En retrospectiva, el c6digo de la vida es siqlple y directo. po, y tal vez nos indique la raz6n de que el mundo y nuestra En nuestro mundo de separaciones, un mundo en el que redu- existencia en ocasiones parezcan no ser perfectos. cimos el estudio de la naturaleza a dencias que aparentemente Como el nombre ShaDaY representa s610 un aspecto de no se relacionan, se han perdido las conexiones y se ha oscure- Dios, su nombre personal permanece sin cambio; Dios se si- cido el mensaje. El descubrimiento de que el nombre de Dios gue identificando como YHVH. Cuando aplicamos la gema- esta en el interior de nuestro cuerpo nos muestra el beneficio , tria en un capitulo anterior, convertimos las letras de YHVH de unie diversas formas de conocimiento en una sola com- al codigo numerico del alfabeto hebreo. El proceso revelo que prension. AI cruzar los l1mites tradicionales que definen ellen- cl nombre de Dios es el numero 26, que redujimos a 8 suman- guaje, la historia y la religi6n, se nos muesrra el poder de una do los digitos 2 y 6. Y aplicamos el mismo procedimiento a los visi6n del mundo mas grande e integrada. Tal vez en la simpli- valores de nuestro ADN; YHVG, sin embargo, produce un cidad del c6digo, el mensaje riene esa misma sencillez. numero que, aunque es similar, es un poco menor. El c6digo numerico oculto del ADN de la humanidad arroja estas cifras: 10 + 5 + 6 + 3, es decir, 24. La suma de 24 La perfecci6n del alma es el valor codificado de 6. Este valor declara y confirma en a ~Que revela el mensaje que est en el interior de nuestro cuerpo ' numeros, 10 que los textos ya revelaron en palabras. Aunque sobre nuestro papd en la cread6n? En los capItulos anteriores, compartimos los atributos del nombre de Dios, la ultima letra se describi6 c6mo los textos de la antigiiedad relacionaron el de nuestro cuerpo fisico, Gimef, nos recuerda que no somos nombre de Dios con la forma en que su presencia se dio a . i.t,ruales aDios (ver la Figura 7.1). conocet en un momento dado del tiempo: el Dios de la Mise- ricordia, e1 Dios de la Creaci6n, y asf sucesivamente. Ellibro del Genesis proporciona algunas de las claves mas poderosas Nombre eMlgo Cuerpo del ser C6digo para comprender nuestro papel en el desrino de nuestra espe- . deDios en tefras Humano (AnN) en Letras de. En hebreo, su idioma original, el texto revela que durante y 10 Y 10 al acto de la creaci6n, Dios detuvo e1 proceso antes de que .• H 5 H 5 estuviera ~ompleto (Genesis 17: 1). La traducci6n de este inci- V 6 \I 6 dente dice asf: "Yo soy Dios el Creador, que ha hablado 10 fj 2- ¥ J.. suflciente. Camina en mi presencia y !lega a ser pcufecro" [el 5uma 26 Suma 24 auror afiadi6 las iralicas). EI nombre que se atribuye a este Re<lucido 8 keducJdo ·6 aspecto de Dios es ShaDaY, una contracci6n de dos palabras hebreas, She-amar Day, que podrfan traducirse como "El que I·ij.,rura 7.1: Comparaci6n del nombre de Dios como elemento de nunll'll mundo, y nuestro nombre como aparece en el c6digo en nUf..' stras n:llIlas, dijo suficiente, detente". 1 En una sola frase, se nos muesrra el ( :omo nos dice la tradici()n. auol..Jue tencmos una rclacibn con Dins, 1111('" potencial que eI nombre de Dios nos permite en nuestro cuer- I ro ser Hsico, (cl ('arbono 0 hi (; de (;imd) no nos pl'rmill'Sl'r i,...uak·s., 1".1. 182 El C6digo de Dios Mensaje del primer dfa 183 Las palabras de Genesis 17: 1 son muy prec;;isas. Implican en el hecho de que en algun momenta entre esos "sucesos es- que el acto de la creaci6n se detuvo s610 en 10 que concierne a poradicos" adquirimos las caracterfsdcas que nos dan un lugar 10 que llegadamos a ser. En terminos modernos, esto podda aparte entre todos los seres vivos. interpretarse como una dedaraci6n que se rdaciona menos Tattersall y Matterness hablan en su articulo de nuestro con nuestra perfeccion fIsica y que tal vez se re1aciona mas con caracter unico diciendo que el Homo sapiens encarna caracre- las cualidades sutiles a las que aspiramos como seres humanos. I risticas que "indudablemente son inusuales" y afiaden: "Sin Aunque como cuerpo estabamos completos en el momento . importar que sea ese 'algo', se re1aciona con la forma en que en que Dios detuvo el proceso (es decir, en nuestra forma fIsi- interactuamos con e1 mundo externo: tiene que ver con la con- ca), se nos dej61a elecci6n de los atributos no flsicos yespiri- ducta..." Tales observaciones sugieren que es obvio que ha ocu- tuales que nos permitirian lograr nuestro potencial y alcanzar ' rrido derta forma de evoluci6n fIsica. Las cualidades de nuestra la "perfecci6n". Al ordenarle a la humanidad que "llegara a ser espede que han sufrido los mayores cambios podrIan ser los perfecta", Dios nos dio e1 mandato de cambiar, de evolucionar atributos intangibles que nos hacen unicos, como la forma en y de participar en la tarea de completar el mundo y nuestra' que manejamos la vida y en que nos tratamos unos a otros; esencia: el mandato de ser co-creadores. \ nuestra expresi6n del amor, de la compasion, y nuestros pode- res de discernimiento que brotan de pensamientos, sentimien- ros y emociones. Evoluci6n de la esencia A traves de las caracterIsticas de sentimientos y emocio- La historia escrita que se revela en la mayorfade los textos de la:: nes que nos apartan de otras formas de vida,2 es claro que antigliedad y el descubrimiento de restos humanos modernos hemos "evolucionado" para llegar a ser mas que los ancestros que ahora se sabe datan de hace 160,000 afios (Capitulo 2) ~ que nos precedieron hace cientos de miles de mos. Esta com- sugieren que nuestra forma flsica ha cambiado muy poco des- ; prension apoya la evidencia fisica re!adonada con nuestra evo- de nuestros inicios. Aunque los f6siles encontrados ofreceri " luei6n. Nuestra capacidad de trascender el dano que causan evidencia Hsica de una progresion evolutiva, la diversidad de' . las desilusiones de Ia vida 0 de perdonar a aquellos que han nuestro pasado sugiere que hubo muchas curvas en el camino., traicionado nuestra confianza, por ejemplo, nos permiten re- En su contribucion a la Edici6n Especial de fa revista Scientific definir 10 que estas experieneias significan en nuestra vida. American (vol. 15 no. 2, de julio de 2003) Ian Tattersall y Jay Conforme cambiamos nuescra percepcion, en un sentido Matternes hablan de este fenomeno: "La historia de la evolu- muy literal re-definimos tambien a nuestro cuerpo. La capa- ci6n humana no ha sido la lucha lineal de un solo heroe. Mas ' cidad de mejorar las funciones inmunes, de cambiar el nivel bien ha sido la historia de ajustes de la naturaleza: repetidos de nuestras hormonas y alterar el ritmo cardiaco, la respira- experimentos de evolucion. Nuestra historia biol6gica ha sido ci6n y el metabolismo, con solo cambiar la forma en que nos una hisroria de sucesos esporadicos mas que de incrementos sentimos, esta bien documentada en la literarura ciendfica y graduales". Tal vez e1 mayor misterio de nuestra evoluci6n esre medica. 3• 4 184 El C6diga de Dias Mensaje del primer dfa 185 Sin embargo, la afirmacion de la version <;lel Genesis que dase, se completo el tan esperado primer trazo del genoma encontramos en la Tora: "Ahora caminen frente a mi y Ileguen humano, la formula quimica del cuerpo humano. a ser perfectos" podria no ser una observacion sobre nuestra "Trazar el mapa del genoma humano se ha comparado con imperfeceion, sino una invitacion a trascender los retos que llevar al hombre a la luna, pero creo que es mas que eso", de- cada uno de nosotros enfrenta en la vida. As1, cumplimos nues- claro el Dr. Michael Dexter, director de Wellcome Trust, que tro destino de una mayor perfeccion, un destino que solo esni , finaneiola porcion del proyecto que correspondio a Gran Bre- a una letra de distancia del espejo de la imagen de Dios. tana. 5 AI comentar mas a fondo la importancia de la creacion Aunque exteriormente reconocemos la posibilidad de nues- del primer mapa genetico humano, Dexter especulo que ade- tra relacion con un poder superior, ~es posible que con el paso mas de ser un logro clave en nuestro periodo de vida, podria " del tiempo y en nuestra lucha por sobrevivir, hayamos olvida- ' ~ ser "ellogro extraordinario... en la historia de la humanidad". do el significado implicito en esa relacion? Si creemos que Pero ademas de responder preguntas sobre nuestra naturaleza nuestra familia humana es el resultado de \.lna mezcla "casual" genetica, el terminar el primer mapa genetico revelo una sor- de moleculas que tuvo como resuftado nuestra especie inteli- \ presa que pocos esperaban. gente y compleja, entonces dene sentido que estemos solos en, Para asombro de los equipos que informaron los descubri- el cosmos y que nuestra supervivencia realmente se base en el ;~. mientos, se anuncio que e1 mapa genetico parece tener menos mas fuerte y el mas apto. Si por el contrario, descubrimos que ' genes de los esperados. Cuando se inicio el proyecto casi dos nuestra familia global fue "creada", que somos el producto .' decadas antes, se crda que se requerian unos 100,000 genes intencional de una inteligencia superior, entonces el sentido ", para deBnir el cuerpo humano. Entre los primeros hallazgos de nuestro papd en la creacion tambien debe cambiar. Quizas que se informaron en 2001, estaba el descubrimiento de que nuevas claves, como las que encontramos alleer el ADN hu- " los humanos solo tienen mas 0 menos una tercera parte de los mano como un lenguaje original, puedan ayudarnos a com..', genes que se calcularon originalmente. prender mejor la naturaleza de nuestra evolucion. AI final" Segun Craig Venter, presidente de fa empresa que dirigio a podrfamos encontrar que la respuesta a nuestro misterio esta uno de los equipos que trazaron el mapa: "Solo tenemos 300 en el corazon de nuestro mapa genetico. genes 6nicos en el genoma humano, que no estan presentes en el raton". 6 Francis Collins, jefe del grupo norteamericano del El misterio del Genoma Humano: proyecto, comento sobre las implicaciones de estos descubri- lQut nos hare diferentesl mientos: "Nos fue dificil explicar el mecanismo de control [ge- netico] cuando pensabamos que eran 100,000 genes. Ahora En junio de 2001, se a1canzo un hito en 10 que las generacio- solo tenemos una tercera parte".? Dando un paso mas con nes futuras podrian reconocer como uno de los mayores 10- respecto a los hallazgos de su equipo, Venter dijo: "Esto me gros en la historia de la ciencia. Despues de 20 afios de dice que no es posible que los genes expliquen todo 10 que nos investigacion, en el esfuerzo de cooperacion mas grande de su haee ser 10 que somos".11 186 El C6digo de Dios Mensaje del primer dia 187 Sin reducir en forma alguna la importancia de los logros dicen que al primer ser de nuestra especie se Ie infundi610 que del Proyecto del Genoma Humano, sus hallazgos se agregan a se ha descrito como una "chispa" especial, un filamento particu- la creciente sospecha de que todavIa falta algo en nuestra com- ' lar de eseneia espiritual que nos une eternamente con otros prensi6n de los organismos vivos. En algun punto del trayecto miembros de nuestra especie y con nuestro Creador. Esta chis- de los descubrimientos que han llevado a las sofisticadas ex- pa es 10 que nos aparta de todas las demas formas de vida. Tal plieaciones de la vida que tenemos en Ia actualidad, al parecer vez es la misma fuerza que haee que nuestro codigo genetico un dato clave se ha pasado por alto, se ha omitido, 0 simple- tambien sea diferente. mente se ha olvidado. Venter reitero esta idea cuando se Ie pidio que hablara sobre la imporrancia de estos sorprendentes La fuerza que esta en tow partes, todo descubrimientos. "Creo que es claro que todos nuestros com- e[ tiempo, y responde a [a emoci6n humana portamientos, nuestro tamano y nuestras funciones tienen un eomponente genetieo, perc los ge~es solo explican una parte En anos recientes, algunos cientffieos han sugerido que nues- del proceso". 9 tro mundo moderno ha superado la necesidad de una espiri- Quiza en los primeros anos del siglo XXI, solo estamos tualidad basandose en explieaciones sobre los misterios de la empezando a comprender las implicaciones de tales hallazgos, vida. En la revista noticiosa alemana, Der Spiegel, el renom- y de 10 profetieo que es en realidad el comentario de Venter. A brado fIsico teorko Stephen Hawking ilustra este punto de 10 largo de siete milenios de historia, nuestras pr:kticas espiri- vista diciendo: "Lo que hke fue mostrar que es posible que la tuales, nuestras tradiciones religiosas y la Iiteratura sagrada nos forma en que empezo el universo se determine mediante las han aconsejado reconocer que la vida humana es mueho mas leyes de la cienda... Esto no prueba que no exista un Dios, que huesos, carne, musculo y pdo; mueho mas de 10 que es solo indica que Dios no es necesario". 11 Descubrimientos re~ obvio a primera vista. Ahora, con el uso de sofisticados instru- . cientes en el campo de la ffsica cuantica que esta evoludonan- mentos y gracias a las mentes mas privilegiadas de nuestros ' do a gran velocidad, sugieren ahora que las "leyes de la cienda" tiempos, un estudio de dos deeadas de duracion para trazar el que mendona Hawking y el "Dios" de las tradidones espiri- mapa del eodigo genetieo humano ha llegado precisamente a tuales podrIan de hecho estar relacionados en formas sorpren- la misma conclusion: "Estamos aquI como especie", observo dentes e inesperadas. iAl final, podrlamos deseubrir que se Venter, "porque tenemos una adaptabilidad que llega mas alia refieren predsamente a la misma fuerza! del genoma". 10 Desde los estudios que doeumentan que es posible que mu- Con solo 300 genes que nos separan del raton del campo, chos atomos coexistan exactamente en el mismo lugar y en el ~que nos hace tan diferentes? AI final, podrfamos descubrir mismo instante del tiempo sin chocar unos con otros,12 hasta que la respuesta a esta pregunta es precisamente la clave que el anuncio de fa Universidad Nacional de Australia re1acio- esta en el eorazon de nuestras creendas y tradiciones religiosas nado con la teletransponacion de un rayo de luz (desmante- mas preciadas. Casi a nive! universal. los rdatos antiguos nos lando eI rayo en una ubicacion y volviendo a ensamblarlo en 188 El C6digo de Dios Mensaje del primer dia 189 ona),13 y el fenomeno de los "protones gemelos" (dos unida- ~ Ala luz de los nuevos descubrimientos en el campo cuan- des de luz creadas a partir de un progenitor) que reflejan su ' tico, ha surgido la disposicion a regresar a la sabiduda que se comportamiento mutuo incluso cuando se les separa a distan- , preserva como los rdatos mas antiguos de la creacion. Aunque cias de muchas millas,14 en los ultimos diez anos del siglo XX .' los lenguajes obviamente pertenecen a otras epocas, los temas fue obvio que los fundamentos mismos de nuestra vision del .' que describen son extraordinariamente similares a las revela- mundo estaban cambiando en forma dramatica. dones cientfficas de finales del siglo XX. Muy similar a la con- ~Que podrfa explicar tales observaciones? Nuevas investi- ' sideracion actual de que una sola fuerza unificadora es la dave gaciones empezaron a implicar que todos los sucesos de la crea- . para el estudio de la fisica, el principio de una sola fuerza to- cion, desde sustancias subatomicas diminuras hasta las enormes dopoderosa en la base de la vida establece una continuidad y distantes galaxias, se relacionan de alguna manera. Ai reco- , entre los rdatos mas antiguos y mas diversos sobre los orige- nocer la existencia de una forma de energfa antes desconodda. :, nes de la vida. Con este poder en mente, una vision mas los dentfficos se encontraron repentinamente en el territorio cuidadosa de los textos editados y restaurados de la antigua inexplorado de un mundo donde la lfnea divisoria entre la ' literatura cristiana, hebrea y gnostica, ofreee indicios adido- denda tradicional y el mundo mfstico de las fuerzas invisibles· nales sobre la esquiva distincion que nos aparta de otras for- ~mffi~cl~. ' mas de vida. A este campo de energfa nunca antes reconocido, se Ie han .: dado nombres como "Mente de Dios". "Mente de la Natura-.: leza" y "Holograma Cwintico", y se describe como una fuena 'II "y el hombre lleg6 a ser un alma viviente" que esra en todas partes todo el tiempo, que ha existido desde; Una de la primeras c1aves sobre el misterio de nuestro eanicter el Principio y que demuestra una inteligencia que responde a ' unico es la distincion que estos textos haeen entre el euerpo nuestras emociones mas profundas. En terminos modernos. '" humano y la chispa de la esencia de Dios que anima a ese tales descripciones parecen sorprendentemente similares a las cuerpo. En versos que se encuentran en las versiones restaura- refereneias antiguas de Dios. das de las traducciones bfblicas, se nos ofrecen claves sobre Tal vez d poder de los nombres solo sea el principio de una este misterio como afirmaciones que declaran que "YaHWeH clave rdacionada can la magnitud de los descubrimientos que ... formo al espiritu humano... "16 y el Senor YaHWeH declaro: esta fuerza todavia no ha revelado. Las implicaciones de una "Pondre en ti mi espiritu... "17 Aunque tales rdatos podrfan ser fuerza tan sutil y siempre presence ofrece daves que posible- exactos, careeen del tipo de detalles que nos ayudan a darle mente expliquen misterios como atomos que estan en dos luga- sentido a nuestra misteriosa existencia. Sin embargo, en los res a la vez, comunicacion entre atomos a grandes distandas, y textos gnosticos "perdidos" que ya se han mencionado. se nos la salud de nuestros cuerpos. 15 Ai mismo tiempo, el reconocer da una comprension mas profunda de las surilezas del alma ese campo, ofrece un muy necesario puente entre la ciencia mo- humana y como empez6 a existir. derna y las descripciones anriguas de una fuena de cstc tipo. 190 El C6digo de Dios Mensaje del primer dfa It) I Entre el tesoro de documentos que se reClJperaron en la La humanidad tiene la sabidurfa Biblioteca Nag Hammadi, habia un extrafio texto de los de los angeles en cuerpos de Ia TIerra Mandeanos, la unica secta gn6stica que sobrevivi6 hasta tiem- La Haggadah, por ejemplo, ademas de afirmar que la humani- pos modernos. Los textos Mandeanos distinguen a la "hu- \ dad fue creada espedficamente como un puente entre los mun- manidad" como una forma de vida ajena a este mundo y se dos del cielo y de Ia Tierra, describe con precisi6n que cualidades concentran en el cacaeter unico de nuestra experiencia en la de los angeles del cielo y de las criaturas de la Tierra se unieron Tierra. Empiezan su narraci6n describiendo la creaci6n de para crear la espede humana. De manera espedfica, hemos Adan en un texto titulado Creacion del mundo y del hombre heredado cuatro cualidades de los angeles que contribuyen a ajeno a It. nuestra naturaleza unica. 22 Y son: El texto hace una distinci6n inequivoca entre el euerpo de l Adan y el alma que entra en ese cuerpo despues de que se ha . • nuestro "poder del habla", formado. S610 despues de que se infunde en,Adan la misterio- sa fuerza de la "vida", su euerpo despierra y el se anima. Ha- • nuestro"intelecto analftieo", ciendo eeo a otros textos gn6sticos que describen la creaci6n • nuestra capacidad de "caminar erectos", y de Adan como un esfuerzo colectivo entre los angeles de los • la "mirada" de nuestros ojos. delos, el manuscrito empieza diciendo que, bajo la direcci6n de Dios, "ellos crearon a Adan y 10 acostaron, pero no habia en Nuestro "poder del habla" representa un doble poder que el un alma. Cuando crearon a Adan, no pudieron introducir no compartimos con ninguna otca forma de vida en la Tierra. en el un alma" .18 S610 despues de que "el resplandor de la vida La ciencia ha demostrado que la vibraci6n afecta muy profun- habl6 en el [Adan], abri610s ojos del cuerpo" .19 darnente a nuestro mundo fisico. Desde la magnitud de la fuerza Otro texto gn6stico, conocido como La Hipostasis de los que acaba con dudades enteras durante un terremoto, hasta la Arcontes, es una interpretaci6n mistica de los primeros libros fuerza menor que sana nuestro cuerpo mediante una emoci6n del Genesis. Se cree que data del tercer siglo de nuestra era. 20 poderosa, los efectos son el resultado de la vibraci6n. EI habla La narraci6n contiene una descripci6n adicional de la crea- nos permite hacer audibles nuestras vibraciones. Con nuestra ci6n de Adan que distingue claramente la esencia viviente del habilidad de "hacer vibrar" el diafragma en nuestro abdomen espiritu de Adan como algo distinto a su cuerpo y separado de y hacer salir la cantidad exacta de aire entre los musculos de eL "Y el Espiritu lleg6... descendi6 y vino a vivir dentro de el, nuestras cuerdas vocales, creamos las poderosas vibradones que y ese hombre lleg6 a ser un alma viviente. Lo llam6 Adan... "21 sanan nuestro cuerpo y cambian al mundo. Ademas, con nues- Para ver con mas claridad 1a naturaleza precisa del espfritu tras palabras, preservamos el recuerdo del pasado y comparti- de Adan, exploraremos los fundamentos de las tradidones he- mos con otros las experiencias que mueven nuestras almas. brea y cristiana, por ejemplo, en el Talmud. 192 El C6diga de Dias Mensaje del primer dfa 193 Lo que nos permite elegir cuando y c6mo compartir nues- ' Para equiJibrar los rasgos que compartimos con los ange- tras creencias con otros utiJizando nuestro poder del habla, e' les, tambien tenemos cuatro caracteristicas que hemos hereda- incluso decidir si vamos a compartirlas, es el poder de nuestro do de "las bestias del campo"23; "intelecto analitico". A traves del intelecto, podemos conside- 1. "Comemos y bebemos". rar las consecuencias de nuestras acciones antes de actuar, en '. lugar de vivir en un estado perpetuo de reacci6n, intentando 2. "Segregamos el material de desperdicio de nuestro cuerpo". "arreglar" las elecciones que lamentamos. 3. "Propagamos nuestra especie". Gracias al don de "caminar erectos", damos libertad al usa 4. "Morimos". de nuestras manos y brazos, permitiendo la movilidad necesa- ria para llevar a cabo las acciones que consideramos dignas de ' Es obvio que los autores de estos textos crelan que, como des- dedicarles nuestro tiempo. Gracias a nuestra postura erecta, cendientes de Adan, tenemos la chispa que nos une con nues- hemos tenido la habiJidad de construir nuestro mundo, de tro Creador de una manera que no compartimos con ninguna expresar nuestras emociones mas profundas y de cuidar de otros' otra especie. y de nosotros mismos en una forma que no se ha otorgado a' Tal vez algunos de los detalles mas importantes relaciona- ninguna otra criatura sobre la Tierra. Desde la perspectiva de"· dos con la naturaleza del alma en sf tambien se encuentren en que la vida es un reflejo de nuestra capacidad consciente, nuestra la Haggadah. Con dtulos como Los Angeles y la creaci6n del postura erecta tambien podria verse como una metafora de Hombre y La creaci6n de Addn, los textos ofrecen una narra- nuestra capacidad de "erguirnos" y "elevarnos por encima"i ci6n que describe c6mo era Adan despues de recibir la esencia de las tribulaciones y desaffos con que nos reta la tierra que de Dios como su alma. AI describir las cualidades de la chispa de pisamos. Dios, el texto hace una referencia clara e inequivoca al genero La "mirada de nuestros ojos" es tal vez el mas elocuente de: del alma de la humanidad. "Pues Dios dio forma a su alma los dones que nos otorgaron los angeles. Se dice que con los:' con especial cuidado. Ella es la imagen de Dios, y as! como ojos se nos dieron "ventanas del alma". Cuando miramos a' Dios llena el mundo, el alma Hena al cuerpo humano" [el au- alguien a los ojos, ocurre mucho mas que un simple proceso tor afiadi61as idlicas] .24 de luz y 6ptica. A rraves de la manera en que elegimos para. En este pasaje se nos dan dos claves importantes sobre la mirar a otros y la forma en que permitimos que orros nos mi- . naturaleza de Dios. Primero, se nos dice que el cuerpo de Adm ren, intercambiamos cantidades enormes de informaci6n so- estaba impregnado con una fuerza que, por su disefio, era fe- bre nuestra actitud mental, nuestra salud, nuestros sentimientos menina. Aunque esto no impide que otros aspectos espiritua- y deseos de una ,manera que es exclusiva de nuestra especie. les de Adan sean masculinos, la Frase afirma claramente que la Con el don de la "mirada" que nos dieron los angeles, cada esencia que se infundi6 en el primer ser de nuestra especie era uno de nosotros tiene el poder de sanar 0 destruir, de amar u fcmenina. En segundo lugar, contrario a las interpretaciones odiar, con el mensaje que transmitimos. lradicionales que identifican a Dios como "EI". el pasaje im- 194 El C6digo de Dios Mensaje del primer dfa 195 plica que la naturaleza femenina de alma de Adap es, al menos "El Hombre es el unico que fue creado por la mann de en parte, identica a la de su Creador. · "26 D lOS. Aunque estos textos podrfan ser la fuente de cuestionamien- El texto continua diciendo: "Todas las demas criaturas fue- tos sobre el genero de Dios en la Tierra, a partir de estos ejem- ron creadas por la palabra de Dios". Con esta distind6n, el plos es obvio que el "espiritu" de Dios es una fuerza distinta y cuerpo de cada ser humano se describe como un "microcos- separada que se introdujo en Adan despues de la cread6n de su mos, todo el mundo en miniatura". Por otra parte, el texto cuerpo. En vista de que las traducciones tradidonales de la identifica al mundo que nos rodea como un espejo de nuestra Biblia no cuentan con este nivel de detalle, nuestra compren- naturaleza colectiva: "El mundo es un reflejo del hombre".27 si6n de la naturaleza del cuerpo y el espfritu por 10 general se No fue sino hasta finales del siglo XX que la cienda moderna limita al pasaje familiar de la version bfblica del Genesis: "El confirm6 que eJ mundo que nos rodea en efecto refleja nues- Senor form6 al hombre del polvo del suelo e insufl6 en sus tros estados emocionales mas profundos. 28 De nuevo, se nos narices aliento de vida y result6 el hombre qn ser viviente".25 ofrece, con palabras de otras epocas, un concepto poderoso. Es obvio que esta frase tambien describe el momento de la Si nos aventuramos mas alla de la sabiduria convencional cread6n de la vida humana, pero combinada con los pasajes ' que sugiere que pasajes como los de la Haggadah son s610 me- mas antiguos y mas espedficos, contribuye a nuestra compren- taforas del pasado, veremos que nos presentan una nueva ma- si6n general del car:icter unico de la esenda de nuestra exis- : nera de comprender 10 que significa llevar el nombre de Dios tenda. A traves del poder misterioso del alma, se nos ofrece la en cada una de las celulas de nuestro cuerpo. El comun deno- oportunidad de mejorar nuestra vida ydejarles un mundo mejor minador de las descripdones amiguas es que a Adan, como el a nuestros descendientes de una manera que no esta al alcance . primero de nuestra especie, se Ie infundi6 un don que no dene de ninguna otra criatura sobre la Tierra. igual en todo el universo. Con el primer acto de la creaci6n de la vida humana, Dios l Que significa e[ hecho de teneT comparti6 parte de SI mismo al "infundir su aIiento" en nues- el nombre de Dios en nuestro cuerpo? tra especie. AI hacerlo, asumimos el papel de "recipiemes", dotados de manera unica con el esplritu divino. Hasta la fe- Quid la raz6n de nuestro caracter llnico sea que nuestros cuer- ; cha, seguimos teniendo ese pape!, pues el antiguo secreto de la pos estan disenados espedficamente como recipientes de la creaci6n de este recipiente se ha preservado y se ha transmiti- "chispa" de Dios. Aunque toda vida esta hecha de elementos do en el milagro de cada vida humana. Quiza la respuesta al que equivalen al nombre de Dios, los textos antiguos son muy misterio de 10 que nos hace diferemes permanece oculta den- claros cuando dicen que Dios s610 infundi6 su espfritu perso- tro de la diminuta molecula que contiene el c6digo de la vida nal en la vida humana. La Haggadah apoya esta distinci6n, misma: nuestro ADN. especificando que el hombre es la llnica criatura bajo el delo Desde esta perspectiva, nuestro c6digo generico podr,a con- en cuya formacion intervino Dios a nivel ffsico y personal. siderarse una antigua f6rmuJa que define la calidad dd red- 196 El C6digo de Dios Mensaje del primer dfa 197 piente que es necesario para llevar la esenc~a de Dios. Con Como una expresi6n del poder de la creacion, solo noso- frases cuyo significado es muy claro, muchas tradiciones esp~­ tros participamos en los sucesos de nuestro mundo, creamos la rituales sefialan que nuestros cuerpos son estructuras constrUl- calidad de nuestra vida, y tenemos el discernimiento para ele- das para contener el cielo en el ambito de la Tierra. As! como gir la manera de ser mejores. Solo en nuestro mundo los dlas los templos Hsicos se construyen para albergar en su interior tienen prop6sito, un principio y un fin, y se les puede juzgar un espacio sagrado, los textos hebreos, gnosticos y cristianos como un exito 0 un fracaso. En cada momento del dfa, afir- se refieren a nuestro cuerpo como el "templo" que atberga la mamos 0 negamos el don de nuestro caracter unico segun santa esencia de Dios. la manera en que vivimos nuestra vida. A1 enfrentarnos a los En el Nuevo testamento vemos referencias de nuestro pa- retos mas grandes de la historia, el mensaje que esta en eI inte- pel como templos que al principio aparecen en forma sud!. A rior de nuestras celulas es un recordatorio de nuestro poder y medida que se desenvuelve el misterio de las ensefianzas, esta ; de nuestro caracter unico. referenda se vuelve mas directa. El Evang~lio de Juan dice que Una gran ironia de nuestra epoca historica es que la misma Jesus "hab16 del templo de su cuerpo" .29 En el tercer capItulo tecnologfa que posee el poder de destruir todo 10 que hemos de la Carta a los Corintios, la referenda es mas directa, aunque logrado, tambien posee el poder de revelar que nuestras vidas se presenta como una pregunta que se hace a quienes escu- son una expresion de algo vasto y maravilloso. Las palabras chan: "~No saben que son el templo de Dios, y que el esp!ritu que estan en e1 interior de cada una de nuestras celulas nunca de Dios habira en ustedes?"30 En el sexto capitulo de esta mis- . se han sometido a las ediciones, omisiones 0 interpretaciones a rna carta, el tema se convierte en una dec1araci6n directa: "Tu "J las que han sido sometidos los textos convencionales. El men- cuerpo es el templo del Espiritu Santo que estd en ti':31 [El auror saje permanece imaqo, como era el primer dfa de nuestra exis- agreg6 las italicas]. Habiendo marcado la distinci6n entre el tencia. cuerpo del hombre y e1 Espiritu Santo que mora en su inte- Cuando los sucesos de nuestras vidas nos ponen pruebas rior, tanto los textos can6nicos como los gn6sticos estan de que rebasan la razon, e1 mensaje del interior de nuescras celu- acuerdo en que s610 la forma humana posee la capacidad de al- las permanece como un sfmbolo viviente e inmutable, una pie- bergar al esplritu de Dios. dra de toque que nos recuerda que: Expandiendo la descripeion de nuestros cuerpos como estructuras que albergan la esencia de Dios, la Cabala nos invi- , • No estamos solos. ta a profundizar el misterio aun mas, al describir como los recipientes de la luz de Dios (las "vasijas" que se describen en • Estamos aqui "con un prop6sito", como resultado el Capitulo 5), se hicieron pedazos y cayeron a las regiones de un acto intencionaI de creacion. espirituales inferiores de la Tierra. AquI en las regiones terrenas • Estamos unidos unos a orros) y a toda vida, de ma- donde conviven las tinieblas y la luz, las vasijas tomaron nueva nera inextricable. forma y pudieron comunicar su luz al mundo de los humanos. . 198 El C6digo de Dios Mensaje del primer dfa 199 • Compartimos una caractedstica unica: la.esencia de la vida a partir de materia carente de vida nunca se ha docu- Dios, de tal manera que eso nos aparta de todos los mentado dentificamente en condiciones de laboratorio. De demas seres vivos de la Tierra. hecho, los dendficos reconocen que la posibilidad de que la vida surgiera meramente al azar es, en el mejor de los casos, l Es [a vida una eleeci6n mfnima. Francis Crick, que recibio el Premio Nobel, comento o una casuaIidad? sobre las numerosas y diversas condiciones complejas que de- En el hecho de reconocer las mfnimas posibilidades de que la" berian existir para que apareciera el primer destello de vida. vida se originara por casualidad, podrfamos captar el signifi- "Un hombre honesto, armado con todo el conocimiento dis- cado del mensaje del interior de nuestras celulas. En el Capi- ponible a la fecha, solo podrfa decir que, por el momento, el tulo 1, se da una definicion de sistemas de vida desde el punto '., origen de la vida parece ser, en cierto sentido, casi un milagro, de vista de la quimica, y se describe la vida como "un patron de tomando en cuenta las numerosas condiciones que tendrian comportamiento que dertos sistemas qufmicos alcanzan cuan-; que haberse satisfecho para ponerla en marcha".34 En cuanto a do llegar a cierto nivel de complejidad" .32 En una porcion pos- " casualidades y probabilidades, la posibilidad de que esto suce- terior del mismo texto, los autores profundizan su definicion' diera es pnkticamente nula. y sugieren que la vida es el resultado de "sistemas quimicos' El not~ble astr6nomo britanico, Sir Fred Hoyle, y la astro- complejos y organizados que se propagan, crecen, metabolizan, . noma y matematica de la Universidad de Cardiff, en Gales, usan su entorno y se protegen de el, y evolucionan y cambian Chandra Wickramasinghe nos dan un contexto para apreciar en respuesta a modificaciones a largo plazo en el entorno'',3' ,: la magnitud real de esta imposibilidad. Suponiendo que algu- Aunque definiciones de la vida de aspecto tan esteril podrian j nos de los factores que apoyan a las formas de vida mas sim- describir 10 que hace la vida, no abordan la manera en que la; ples hayan existido en algun momento del pasado remoto, se vida lleg6 a existir. calcula que las posibilidades de que una combinacion aleato- El que la vida haya surgido por casualidad 0 mediante una ria de moleculas produjera incluso la forma de vida mas sim- serie intencional de sucesos ordenados, ha sido tema de con- ple, sedan mas 0 menos de 1 a 1040,000 (ies dedr 1 seguido de troversias desde el nacimiento del metodo ciendfico haee 40,000 ceros!).35 Aunque redujeramos esta cifca con un factor aproximadamente 400 arros. Esta es la cuesti6n: ~Reacciones de la mitad, la posibilidad de que elementos combinados al qufmicas al azar, en el interior de la "sopa" pristina de la crca- , azar produjeran una vida compleja en los 4.5 billones de arros cion, dieron origen a las primeras celulas vivientes? (0 intervi- ' que se calcula dene la Tierra, es minima. no una fuerza diferente, que aun no se ha identificado, y que En su texto clasico Molecular Biology ofthe Gene 36 {Biolo- desemperro el pape! de organizar las sustancias quimicas del gia molecular delgen}, James Watson describe el caracter unieo mundo para formar la vida de nuestros cuerpos? yel misterio de las celulas vivas. "Debemos admitir de inme- En el momento de escribir este libro, no existe una teoda diato que la estfuctura de la celula nunca se entended como sc viable que describa eI origen qu{mico de la vida; la crcaci6n de 200 EI C6digo de Dios Mensaje del primer dfa 201 entiende la estructura de las moleculas de agua 0 de glucosa.' sian Viking a Marte en 1976. EI descubrimiento de 10 que al No s610 permaneceni sin soluci6n la estructura exacta de hi,- parecer eran estructuras artificiales en la superficie del planeta, mayoria de las macrocelulas que se encuentran en el interior; provoca una controversia que rodavia existe en la actualidad. 39 de la celula, sino que sus ubicadones relativas en ellas s610, Aunque las estructuras piramidales de dos, tres, cuatro y cinco podran conocerse vagamenre".37 , lados, ubicadas a 10 largo de zanjas de millas de longitud, son AI parecer hay algo relacionado con el proceso que se reali-. obvias para los expenos, Ja pregunta permanece: (Son produc- za en el interior de la milagrosa f:ibrica de cada celula de nues...: to de la naturaleza, 0 son restos de una construcci6n intendo- tro cuerpo que desaHa toda explicad6n mediante la sabidurfa nal de epocas remotas? Aunque la soJuci6n a este misterio podria convencional moderna. A partir de tales observaciones, empe.f requerir una misi6n con tripulantes humanos que diera una zamos a perdbir 10 poco probable que serIa que fueramos el respuesta definitiva, la presencia de principios matematicos cla- resultado de una "casualidad" en la creaci6n. Por tanto, el men;. · estructuras40 clertamente ve en Ias proplas • . suglere que son pro- saje en clave que esni en el interior de cada una de nuestraa ducto de un diselio premeditado. celulas adquiere un significado atin mayor. De manera similar, el descubrimiento de orden en el fun- damento de la vida podria considerarse una senal de inteligen- cia en el interior de esa vida. La revelaci6n de que los cuatro EI orden como sefiaI de inteligencia elementos de1a vida representan las letras dave de un alfabeto En la naturaleza, el orden se ve a menudo como una selial d, anriqufsimo, al igual que el hecho de que ese alfabeto forme inteligencia. La existencia de patrones predecibles y repetibl un mensaje, muestra con mayor magnitud e1 grado de orden que puede describirse mediante f6rmulas universales, es en que se basa la vida. Si a estos poderosos indicadores de una ejemplo de 10 que queremos decir con la palabra orden. 'J fuerza de intenci6n aliadimos e1 hecho de que se ha reconoci- Durante entrevistas candidas en sus ultimos alios, AIbe t do que cada celula de nuestro cuerpo lleva precisamente el Einstein comparti6 su creencia en un orden que subyace a ,: mismo mensaje, tal vez la importancia de este c6digo JIegue a creaci6n, al igual que su sentir sobre el origen de ese ordcnft; ser mayor que el descubrimiento en sf. Durante una conversaci6n de ese tipo, mencion6 en confian~ La presencia del nombre de Dios, escrito en dave en cada za: "Veo un patr6n, pero mi imaginaci6n no puede dar for celula de la vida, no solo preserva un mensaje especial, sino al creador de ese patr6n... todos danzamos al rirmo de Un( que el mensaje en SI riene su propio significado. melodfa misteriosa, producida en la distanda por un Bautista invisible".38 En nuestra busqueda del sentido de nuesrra vida, EI misterio de que "Dios sea Uno" la presencia misma de orden se ve en ocasiones como una se- lial de que algo mas grande esta "aHa fuera". Desde el punto de vista hist6rico. venimos al mundo como Es precisamente este tipo de orden 10 que se observ6. por resulrado de fa union entre un hombre y una mujer, nuesrra ejemplo, en las 60,000 imagenes fotografiadas durante la Mi.. madre y nuestro padrf!. Pm de«i6n 0 por casllalidad. la JnCOl- 202 EI C6digo de Dios Mensaje del primer dia 203 da del ADN que aporta cada uno de sus cuet:pos dene como ': En terminos numericos, el9 es Adan. Con ellenguaje de los resultado una nueva vida dentro del vientre materno. Uno de, numeros, podemos ahora explorar la relad6n de Adan con su los misterios de la vida que en la accualidad se ha intensificado . padre y su madre. Para determinar como se re!acionan el padre con el';dvenimiento de la donaci6n humana, es si el 6vulo y . y la madre con el 9 de Adan, sin embargo, primero es tambien el espermatozoide son 10 unico que se requiere para crear la • necesario encontrar sus valores ocultos. vida humana. (Son suficientes, 0 se necesita alga mas? La palabra hebrea que significa madre se escribe EM.41 De manera espedfica, (cual es la fuerza invisible que "or- dena" a las celulas que crezcan y se dividan precisamente en . E. M la forma correcta y en el momento preciso para producir un (Alej) = 1 (Mem) = 40 nifio 0 nina saludable? (Quien es exactamente el "Bautista" que mencionaba Einstein como la Fuente de nuestra "melo- AI sumar estos valores individuales se produce el valor combi- dia" c6smiea? Un examen mas cuidadoso d~l nacimiento, des- nado de 41, que puede reducirse a 5. Un proceso similar para de fa perspectiva numerica de Ipocas remotas podrla darnos una la palabra "padre", que en hebreo se escribe Av,42 tiene este dave. resultado: AI igual que Adan, la siguiente "ecuaci6n" que representa la uni6n del padre y la madre para producir un cuerpo huma- . no, s610 esta compleca cuando se Ie agrega el valor numerico; A v (Ale£) = 1 (Vet/Bet) =2 de Dios. En el Capitulo 4 se dijo que la palabra hebrea para el· 1 + 2 =3 primer hombre de nuestra especie, '~dan" (escrita sin la se- ; gunda voca!) , es ADM. Aplicando los valores numericos espe- , AI sumar estos numeros se crea el valor de 3. Con las pala- dficos de cada letra, resulta 10 siguiente: bras madre, padre y Addn transformadas a] lenguaje comun de los numeros, podemos comparar "manzanas con manzanas" y A D M examinar las palabras a un nive! mas profundo. (Aid) = 1 (Dalet) = 4 (Mem) = 40 Como Adan (la humanidad) es el resultado de la uni6n del padre y la madre, esperarfamos que su nombre tuviera un va- AI sl!mar estos valores individuales se produce un nuevo valor lor equivalente a los otros dos combinadas. Sin embargo, esto combinado de 45, y cuando se suman el4 yel 5 que 10 com- no ocurre si sumamos el 3 del padre y el 5 de la madre. EI ponen, dan como resultado el valor que representa a Adan: 9. resultado de esta simple operaci6n es 8, uno menos que 9. el valor numerico de Adan. Este aparente misterio Sf rcsuelve 1 + 4 + 40 45 con un solo pasaje de 1a Tara y con fa visi6n profunda del 4 + 5 9 Rabino Benjamin Blech. 204 EI C6digo de Dios Mensaje del primer dia 20-; Aunque muchos investigadores interpre~an los pasajes de + 10 + 6) obrenemos un nuevo valor de 26; jexactamente el las tradiciones antiguas como metaforas, muy a menudo las mismo valor que dene el amiguo nombre de Dios; YHVH! referencias de la Tora son espedficas. El Rabino Blech senala; Ademas de represemar directamente al numero 1 en el alfabe- que el Genesis declara con toda daridad, por ejemplo, que to hebreo, Alef es tambien una referenda indirecta y en clave Dios dene un valor numerico. "El Senor es nuestro Dios, El al nombre personal y a la presencia de Dios. "Uno" es literal- Senor es Uno"43 [el autor anadiolas italicas]. Para algunos eru- mente igual a "Dios". ditos, esta es una declaraci6n directa de que el valor numerico , Aplicando la regIa de relaciones numericas que explora- de Dios es el 1. Pero en el 1 hay un misterio aun mas pro- mos en e1 Capitulo 4, dos palabras cuyos valores se relaeionan fundo. tienen tambien una relacion natural. Desde esta perspecdva, "Dios" es el valor que falta en la ecuaeion de padre y madre C6mo comp[etar [a ecuaci6n de [a vida para que su resultado sea Adan. Ademas de la union entre las cantidades terrenas que aportan e1 hombre y la mujer, e1 espi- En el alfabeto hebreo, el numero 1 se relaciona con la primera ritu de Dios debe esrar presente en Adan (la humanidad) para letra del alfabeto, Alef(tt,}. Las razones mas profundas y los: que este completo. temas complejos que esta.n detnls de la creaci6n de la propia i Alefse han sometido a estudios completos y ciertamente mere-; LA ECUACION DE LA VIDA cen una exploracion mas profunda. Para los propositos del,' misterio de que a las palabras padre y madre les falte un nume- Madre + Padre + Dios = Adan ro para coincidir con el mimero de ''Adan'', limitaremos nues-. 5 + 3 + 1 = 9 tro analisis. AI examinar el origen deAlef, se resuelve el misterio: del pasaje que dice "El Senor es Uno". Mas que un mensaje agregado a la vida como algo poste- Como revela e1 Rabino Blech, la antigua letra Ale!esta.: rior al heeho, el que el eodigo sea la vida nos dice que Dios de hecho formada por la union de dos letras separadas, una de:) existe como nuestro cuerpo. Lo que vemos como aromos de ellas se usa dos veces. En la esquina superior dereeha yen la" carbono, oxigeno, hidrogeno y nitrogeno, el "material" con inferior izquierda de Alef, se eneuentra la letra mas pequenat que se haee la vida, es Dios. Aunque tal vez el codigo no descri- que es la primera letra del nombre de Dios, Yod (~). Estas Yod', ba con precision quitn es Dios, nos dice en terminos utiliza- escan divididas por la letra inclinada vtw (,). Si consideramos . dos por nuestra cieneia, que no podemos separarnos, ni apartar en forma separada cada una de las letras que forman a Alif, a ninguna orra forma de vida en este mundo, de la presencia resolvemos el misterio. de un poder superior. En la forma usual de analizar las letras hebreas como nu- Con la familiar elocuencia que caracteriza al poeta William meros, cada Yod recibe el valor de 10, mientras que a Vav se Ie ' Blake, el resume nuestra reIacion con Dios en unas cuantas asigna el valor de 6. Si sumamos estos valores individuales (10 palabras: 206 El C6digo de Dios Mensaje del primer d[a 207 "Dios es el hombre y existe en nosotros Y. nosotros en el". '. • La aparicion de orden en la naturaleza, que podrfa Ademas de describir nuestra relaci6n can Dios, Blake agrega describirse mediante formulas matematicas univer- que Dios existe como la humanidad para que la humanidad, sales, podrfa verse como la senal de una inteligencia pueda hacer las e1ecciones cotidianas que la acercan mas a la' subyacente. perfecci6n del Creador. "Dios lIeg6 a ser como nosotros, para~ • El hecho de que el codigo de la vida contenga un que nosotros fueramos como el". AI aceptar la sabiduria de . grado tan alto de orden y el hecho de que en su inte- esta declaracion, se nos concede eI poder de trascender los re- rior exista un mensaje, sugieren la presencia de una tos de nuestra vida y las diferencias que alguna vez nos han: inteligencia de mayor magnitud. dividido. • En la ecuacion hebrea para la vida, la simple union de "madre" y "padre" no es suficiente para producir RESUMEN DEL CAPITULO 7 eI nombre de "Adan", el primero de nuestra especie. Falta algo. Solo cuando se suma a la ecuacion la pre- • En ellenguaje original de la Tora, se nos dice que sencia numerica de Dios, las cifras se equilibran y la Dios detuvo la creaci6n antes de que estuviera com- formula esra completa. pleta y ordeno a la humanidad que "caminara en su presencia y lIegara a ser perfecta" (Genesis 1: 17). Los eruditos sugieren que esta dedaraci6n podrla referir- se menos a nuestra perfeccion como cuerpos y mas al hecho de que la esencia espiritual que esta en el interior de nuestros cuerpos desarrolle su potencial. • Un analisis de los valores numericos que represen- tan el ADN de nuestras celulas (YHVG) y los va- lores que representan el nombre de Dios (YHVH) revela que, aunque compartimos los atributos del nombre de Dios, no somos iguales aDios. • Muchos ciendficos, incluyendo a los responsables del descubrimiento del codigo genetico, sugieren que la probabilidad de que la vida haya surgido "por casua- lidad" seria casi un milagro. AI parecer existe una fuerza de la vida que la dencia no ha sido capaz de explicar hasta la fecha. "Los pueblos no pelean porque sean malvados... La guerra se libra ante todo a causa de 10 que es central... eI pan. Ayuda a los n¢cesitados. Alimenta a los hambrientos. Alivia e[ dolOT de quienes sufren hambre.,., Este es el me4io paraevitar la guerra y asegurar [a granbendicion de la pazll. -RABINO BENJAMIN BLECH Capftulo Ocho lOUE HEMOS APRENDIDO? Como sobrevivir en nuestro futuro con las lecciones de nuestro pasado C on las recientes celebradones de fin de siglo todavfa fres- cas en nuestra mente, muchos dendficos. organizado- nes e individuos que se preocupan por la humanidad, est:in planteando la unica pregunta de la que dependen muchas otras: ~sobreviviremos orros den afios como especie? De ma- nera espedfica, ~sobreviviremos otro siglo modificando ge- [1(~ticamente nuestros alimentos, realzando nuestro cuerpo y creando industrias que acaban con la vida en los oceanos, rios v bosques? Quiza 10 mas importante es si nos atreveremos a conrinuar desatando el aplastante poder de la naturaleza como cl arma mas letal que se ha conoddo en la historia de la huma- nidad. Hasta mediados del siglo XX, no tenia sentido plant('ar t"sas preguntas. En la actualidad, eso ha cambiado. Como re- \lIltado de innovaciones ciemlficas que se desarroUaron du- r.lnte la Segunda GUe'rra Mundial. /0 que' induye las de la fllic:a 212 EI C6digo de Dios lOue hemos aprendido? 213 cuantica, la genetica y la electronica miniaturizada, nuesrras bebederos, y que conrinuaban en los banos 0 en las cafererias, opciones recnologicas tienen ahora consecuencias que dura-; par 10 general seguian dos escuelas de pensamienro. ran cienros de anos y a 10 largo de muchas generaciones. Una manera de pensar afirmaba que nuestra capacidad para La pregunta sobre nuestro futuro se relaciona menos con'; "rorcer" las fuerzas de la naturaleza era en si la licencia para el desarrollo de estas tecnologias en si, y mas con la sabiduria: explorar esas tecnologias al maximo. En otras palabras, como necesaria para utilizarlas en nuestra vida. Solo porque rene-, tenemos la capacidad de modificar patrones climaticos y crear mos la capacidad de modificar los parrones climaticos en vas-' nuevas farmas de materia y de vida, deberiamos hacerlo para tas regiones de la Tierra y de crear nuevas formas de vida, por: ver hasta donde nos lIeva la tecnologia. Esta linea de 'razona- ejemplo, itenemos derecho de hacerlo? mienro a menudo lIevo a otro nivel de justificacion que sugie- re que si no se suponia que deberiamos hacer estas cosas, nunca habriamos descubierto los secretos que las hicieron posibles. lOut nos da el derecho de jugar a ser Dios? Una segunda escuela de pensamienro que era mas conser- Desde mediados de la decada de 1970 hasra el principio de la', vadora, sugeria que solo porque tengamos la capacidad de di- decada de 1990, tuve el privilegio de trabajar entre los cienti- senar la vida y la naturaleza, eso no necesariamente significa ficos e ingenieros mas brillantes desarrollando algo de la rec-,~ que tengamos derecho a ejercer nuestro poder. Para quienes nologia mas avanzada que se haya registrado en la hisroria. apoyaban esta linea de razonamienro, las fuerzas de la natura- Para las corporaciones y las universidades, esra fue una epoca leza represenran "Ieyes" sagradas que no deberian manipular- de gran dinamismo; Esrados Unidos esraba re-definiendo su' se. Argumenraban que disenar a la medida los codigos gem:ticos dependencia del perroleo extranjero y esraba luchando par".' de nuestros hijos antes de nacer, y ajustar los patrones climati- conservar su superioridad durante la Guerra Fria y el progra~ cos a nuestras necesidades es "terrirorio vedado", y viola un ma espacial. No es sorprendente que un periodo de investi"; anriguo y taciro deber sagrado. Aunque no necesariamenre se gacion ran intensa estuviera acompanado de una profund:J., dice con estas palabras, el cruzar la linea entre usuario y crea- introspeccion. En un sentido muy real, los cientificos estaban dor, nos coloca en una posicion en la que estamos compitien- explorando los limites de sus recien descubiertas capacidades do con el poder de Dios. para alterar la vida y nuestro planera a un nivel que a 10 largo' Enronces la cuestion se relaciona con 10 que nos da el dere- de la hisroria se Ie habia dejado aDios y a la naturaleza. cho de hacerlo. Este argumento a menudo estuvo acompana- La responsabilidad que acompana a un poder tan asom- do por la metafora de los numeros en el velodmetro de un broso fue 10 que encendiolos candentes debates sobre nuestro coche. Solo porque el velodmetro marca velocidades hasta las derecho etico y moral de utilizar ese tipo de recnologias; deba- , 160 millas por hora, jesto no necesariamenre significa que uno tes en los que participe con enrusiasmo siempre que tuve opor- deba conducir su vehieulo a tal velocidad! tunidad. Los argumentos que encendian las discusiones que Quizas es precisamenre esta metafora del velodmetro 10 empezaban frente a maquinas que expenden comida y junro a que ilustra una tercera lfnea de razonamienro. Si eI velodme- 214 El C6diga de Dias tQue hemas aprendida? 215 tro indica que el vehiculo puede viajar a HiD mi!las por hora, , ternas. Por ejemplo, en caso de que un poder hostilliberara un es muy probable que alguien intente hacerlo en a1gun mo- A- arma biol6gica contra poblaciones que no estaban preparadas, mento. AI parecer es a1go inherente a la naturaleza humana ipodrfamos crear un cambia interno en nosotros que nos hi- Ilegar a los limites y !levar las capacidades al extrema. Sin em- ciera inmunes a esa bacteria 0 virus? Como ya existe la tecno- bargo, la clave es que cuando Ileguemos a estos limites, tam-' logia que se describe en estos escenarios y en muchas otros que bien tengamos el poder para determinar el tiempo, ellugar y no podrfamos describir can justicia en este libro, el debate no las condiciones de la prueba que vamos a realizar. se centraba en si esto era a no posible, sino en que se debiera 0 Podriamos encontrar un tramo desierto de carretera con no desarrollar. buena superficie, en un dia en que el clima es seco y las posibi- Por ejemplo, si re-disefiamos nuestro ADN como respues- lidades de tener un accidente son minimas. 0 podriamos ac- ta a una amenaza biol6gica cercana, ic6mo afectarfa esa elec- tuar impulsivamente y poner a prueba los limites del vehfculo ci6n a la habilidad de nuestro cuerpo para protegernos de en una autopista con mucho tr<ifico, pon,iendonos en peligro y . nuevas amenazas futuras? iCuales son las consecuencias a largo poniendo en riesgo la vida de DrrOS. En cualquiera de estos plaza de cambiar la f6rmula genetica de poblaciones enteras, • ! escenarios, se estin poniendo a prueba los limltes. En uno se : una formula que ha requerido de miles de afios para alcanzar hace con responsabilidad, y en el otro con descuido. Tal vez cI c6digo exitoso que tenemos hoy en dial iEs posible que sin los mismos principios se aplican a la forma en que Ilegamos darnos cuenta amenacemos la supervivencia de nuestra especie a los Ifmites de manipular las fuerzas de la creaci6n. ; por ignorar la forma de aplicar 10 que se cree es una medida que Durante el tiempo en que trabaje en la industria de la de- ;' salvada vidas sin comprender plenamente sus consecuencias? fensa, no era extrafio que las conversaciones se centraran en el Durante los dias de la Guerra Fda, esta era la clase de pre- desarrollo de tecnologias relacionadas con armamento. AI final guntas que casi diariamente hadan quienes eran responsables de la Guerra Fda, cuando los arsenales de las grandes potencias; de hacer realidad ese tipo de posibilidades. Mas de una decada se estaban reduciendo, estas discusiones invariablemente Ileva- despues del fin de la Guerra Fda, siguen siendo algunas de las ban a la pregunta sabre que tecnologias reemplazarian a las ar- preguntas mas urgentes a que se enfrentan las sociedades pre- mas nucleares en el futuro. Se hablaba de poderosos rayos hiser sentes que se basan en la tecnologia, preguntas que deben res- instalados en la superficie de la tierra que podrian hacerse re- ponderse a medida que continuamos nuestra busqueda en el botar contra espejos en 6rbita para destruir objetivos en la Tie- rerritorio inexplorado de disefiar la naturaleza y la vida. Hoy rra, de bombas de neutrones disefiadas para acabar s610 con la en dia, nos encontramos en un mundo en el que hemos con- vida, dejando los edificios, autom6viles y hogares intactos. Una tiado a la ciencia y a los cientfficos la tarea de guiarnos en decada antes, hablar de tales escenarios, que en ese momento , nuestro viaje de exploraci6n, un viaje en eI que existen pocas se abordaban con seriedad, habrfa parecido ciencia ficci6n. I'robabilidades de echar marcha atras. Nuestra esperanza es Ademas de hablar de armas ofensivas can bases externas, que mientras aprendemos a controlar las fuerzas de fa crea- en ocasiones tambien se hablaba de tecnologias defensivas in- Lion. sobrevivamos al pwee,,, dt· aprendizaje. 216 El C6digo de Dios lQue hemos aprendido? 217 Cabe la posibHidad de que existan diez mil nologica". Debido a evidencia arqueologica que posiblemente civilizaciones inteligentes: lD6nde estan1 no estuvo al alcance de Sagan en su tiempo, esta posibilidad ~Es posible que en algun lugar del cosmos, 0 incluso en " ahora parece nula. 1 pasado remota de la Tierra, otras civilizaciones hayan tenid La segunda posibilidad es que otras especies inteligentes experiencias similares y se hayan plameado preguntas par hayan cxistido en el pasado, hayan seguido un camino similar cidas sobre su progreso? ~Es posible que las opciones teen " al nuestro, y ya no existan. Sagan sugirio que la razon por la logicas de sociedades del pasado remoto hayan tenid' eual no detectamos cvidencias de estas formas de vida avanza- consecuencias tan devastadoras que esas civilizaciones ya n', das, es que no sobrevivieron a su curva de aprendizaje y se existan? destruyeron debido al mal usa de las fuerzas de la naturaleza. En 1961, el astronomo Frank Drake formulola ya famos Si este fuera el caso, entonces podriamos estar en el punto ecuaci6n Drake, en la que calcula que es posible que se hay critico de la historia de nuestra especie; estar en peligro de formado diez mil civilizaciones inteligentes en los ultimos 1 cometer los mismos errores y sufrir las mismas eonseeuencias. o 14 ciemos de millones de anos en la historia del universo$ Esta posibilidad ilustra otra consideracion. Tomando en cuenta esa cifra, los cientfficos e investigadores s' Si en realidad estamos viviendo un periodo de adolescen- esran haciendo la pregunta obvia: Si existe la posibilidad d' cia tecnologica, emonees debemos madurar a traves de ella y que hayan existido tal cantidad de civilizadones inteligentes' llegar a las responsabilidades que tales poderes nos permiten. ~donde estin? Si solo una fraccion de esas diez m:! civilizaci De manera similar a la experiencia universal de los ninos cu- nes hubieran existido en realidad, es razonable suponer qu" ya transicion ala edad adulta implica el paso por la adolescen- hayan descubierto los principios universales de la natural ' cia, debemos encontrar la forma de navegar a traves de los que gobiernan el tiempo, el espado y la materia, Tambien cambios de nuestra vida y sobrevivir a la transicion. Como 10 razonable esperar que hayan incorporado esos principios as,' confirmanin los padres de los jovenes, cuando sus hijos entran estilo de vida, como nosotros 10 hemos hecho. Por estas raz ,; a la pubertad, la transicion marca un periodo de confusion a nes, es muy logico suponer que se detectadan en la Tierra se aJustes. nales de comunicacion que fueran evidencia de esas tecnologfaS1 Aparentemente de un dia para otro, los cuerpos de los ni- Hasta la fecha, no se han recibido tales senales. " nos floreeen hacia la edad adulta, 10 que va acompanado de las Carl Sagan, astronomo y colega de Drake, especulo qu t presiones y responsabilidades que definen a un adulto en nues- podda haber dos razones para la ausencia de tales senales en la tra sociedad. A su manera, cada joven debe eneomrarle senti- actualidad. Primero, sugirio la posibilidad de que seamos unt do a 10 que Ie esta ocurriendo, y debe haeerlo pronto si quiere de las primeras civilizaciones en alcanzar el punto de la evolu- sobrevivir. cion en que tenemos la capaddad de utilizar las fuerzas de la, De manera muy similar, durante el periodo colectivo de naturaleza, un periodo que el describe como "adolescencia tee- nuesrra adolescencia ceenologica debemos encontrar una ma- nera de equilibrar eI poder de nuesrros descubrimientos con 218 EI C6digo de Dios lQue hemos aprendido? 219 los valores de Ia vida y la naturaleza. Y tambien de manera siempre, las amenazas que se mencionan en el informe brotan similar, debemos hacerlo rapido. Refiriendonos de nuevo a. de avances cientlficos recientes, y de la manera en que tecno- la analogfa del nino que se transforma en adulto, un riesgo de la '. logfas poderosas han entrado sin freno a nuestras vidas. Desde puberrad es que, para muchos jovenes. su periodo de cambios: temas relacionados con proporcionar suficiente alimentacion va acompanado de un sentimiento que podrfa describirse como' y construir economlas viables, hasta la incertidumbre de tee- "invulnerabilidad". Junto con sus recien descubiertos poderes.: nologlas basadas en los genes y la proliferacion de armas que su sensacion de ser indestructibles con frecuencia los lleva a ser pueden haeer inhabitables regiones enteras del planeta duran- descuidados al poner a prueba los limites de la autoridad y de,; te cientos de generaciones, es obvio que la humanidad Ueva un la razon. Lo triste es que se cree que ese sentimiento de ser curso destructivo en 10 que se refiere a la supervivencia de nues- invencibles es el factor clave de los accidentes automovilisti- tra especie. cos, la principal causa de muerte entre los jovenes en la actua- ~ A finales del siglo XX, muchos cientificos, investigadores y lidad. Accidentes que se atribuyen al hecllO de que el conductor ;' organizaciones, consideraban que Ia deeada de 1990 fue el pun- se arriesgo demasiado. 2 . to en que termino un cicio y la vieron como una opoftunidad Los paralelos entre la adolescencia de los jovenes y nuestra;; para evaluar nuestros erroces al igual que nuestros logros como adolescencia tecnologica ciertamente merecen nuestra consi-· comunidad global. En junio de 1995, durante una eonferen- deracion. Ahora, nuestra supervivencia es mas que una mera cia en Killarney, Irlanda, e1 psiquiatra pionero Stanislav Grof discusion filosofica; dene que ver con nuestra capacidad de· presento un trabajo que reflejaba la preocupacion de muchos reconocer las opciones que afirman 0 niegan la vida en nues-, individuos en relacion a las condiciones de deterioro que ame- tro mundo. nazan a nuestro mundo. 5 Entre los peligros inmediatos que Reflejando la magnitud de la crisis a la que nos enfrenta- f menciona Grof estan los relacionados con "Ia contamina- mos como familia global, la futurista Barbara Marx Hubbard.,: cion del sudo, el aire y el agua debido a las industrias; la ame- habla de la urgencia de esta leccion en terminos muy sencillos, ( naza de desperdicios y accidentes nucleares; la destruccion describiendo nuestra situacion como algo en que "isi no apren... .t de la capa de ozono; e1 efecto invernadero; la posible perdida de demos [que todos estamos relacionados, conectados, y que todo' oxigeno en el planeta debido a la deforestacion irresponsable y es un cuerpo viviente], no podremos respirar!"3 el envenenamiento del pIaneton de los oceanos; y los peligros de aditivos peligrosos en nuestros alimentos y bebidas".6 Re- Nuestra mayor amenaza fIejando los sentimientos de muchos otros cientlficos, cual- quiera de las amenazas que menciona Grof es suficiente para En su informe del ano 2000 sobre el Estado del Mundo, el indicae Ia presencia de un peligro real para los sistemas vitales Instituto Worldwatch [Vigilantes del Mundo] observo: "Ame- de la Tierra. EI hecho de que todos esten presentes en el mis- nazas sin precedente a la estabilidad de nuestro mundo natu- rno momento historico, plantea la posibilidad de una amena- ral nubIan la promesa brillante de un nuevo siglo". 4 Casi za que es casi inirnaginable. 220 El C6digo de Dios ~Que hemos aprendido? 221 it En su artIculo cIasico sobre la Busqueda de Inteligencia, tionada por un panel internacional de expertos para determi- Extraterrestre (SETI),7 Carl Sagan describe una serie similar~; nar quien representara mejor los valores de los ciudadanos de de escenarios que si no se ponen bajo control, cada uno de': la Tierra en caso de un contacto extraterrestre. Como parte del elIos contribuira. af colapso global de las sociedades, tal como:;' proceso de seleccion, se Ie presenta un escenario hipotetico. Si las conocemos. "Hay quienes al contemplar nuesrros problemas· se Ie diera la oportunidad de hacerle una sola pregunta a la globales en la Tierra, nuestros antagonismos nacionales, nues- civilizacion supuestamente avanzada que ella espera encontrar, tros arsenales nucleares, nuesrras crecientes poblaciones, la dis- ,~ 2cual serfa esa pregunta? Despues de una breve pausa, ella res- paridad entre los pobres y los adinerados, la escasez de alimentos ponde con aire pensarivo que les preguntarfa como sobrevivie- y recursos, y las alteraciones que sin darnos cuenta hacemos al;1 ron a su periodo de adolescencia tecnologica sin destruirse. entorno natural de nuestro planera, llegan a la conclusion de, Los parale10s entre este tema de la pelicula Contacto y los que vivimos en un sistema que esta destinado a un colapso'; sucesos que estan ocurriendo en nuestro mundo en la actuali- inmediato".8 Continua sus observaciones'sobre el "estado del, dad son evidentes. Aunque la motivaei6n no es un contacto mundo" con otro punto de vista que se basa en los mismos;, extraterrestre, como civilizacion estamos luchando precisamen- datos: "Hay orros que creen que nuestros problemas tienen.~ te con las mismas preguntas y preocupaciones que la Dra. solucion, que la humanidad todavia esta en su infancia y que l' Arroway presenta ante el panel. (Como vamos a sobrevivir a ' d'la creceremos " .9 algun las capacidades yal inmenso poder que la ciencia y la tecnolo- Es interesante que cuando examinamos muchas de las con..·, gfa han desatado, en especial tomando en cuenta nuestra di- diciones que se han identiflcado como nuestras mayores ame-o':" versidad y tantas ideas diferentes sobre el aspecto que debe nazas, descubramos un factor comlin que las une. Este factor tener nuestro mundo? es la humanidad. Cada una de las situaciones que citan Sagan,: Este tema no es nuevo en la historia de la humanidad. Es el Instituto Worldwatch, Grof y otros, describe escenarios po-' \ importante notar que los registros mas antiguos de la civiliza- tencialmente carastroflcos. Ademas, cada uno de ellos descri.. ' cion humana no nos hablan de milagros y de la belleza de la be a la humanidad como la unica fuente de la amenaza. vida. Por el contrario, en ellos se nos ofrece una vision mo- Tomando en cuenta esas estadisticas, es obvio que en el',' menranea de la lucha antigua y siempre humana con el poder presente ila humanidad representa el mayor peligro para la su- ", y su uso para respaldar creencias e ideas. En la actualidad, ade- pervivencia de nuestra especie! Tambien es obvio que solo no-' mas de los problemas ambientales que son el resultado de la sotros tenemos el poder de garantizar la supervivencia de nuestra cvoluci6n de la industria, nos enfrentamos a una crisis que tal especie y el hecho de que nuestro mundo sea habitable para las vez podria ser mas fundamental para nuestra supervivenda. generaciones futuras. Junto con los peligros que ahora amenazan al mundo de la naturaleza, vivimos bajo la sombra siempre credenre de tec- En una escena que podrfa ser una de las mas profeticas de la nologfas relacionadas con armas que tienen e1 poder de des- peUcula Contacto, fa Ora. Arroway se encuentra siendo cues- cruir la civilizaci6n y h;lc::cr que nuestro phmet;l s610 sea 222 El C6digo de Dios lQue hemos aprendido? 223 habitable para las formas de vida mas sencillas durante cientos ~ supermercados de su vecindario e investigado de d6nde vie- de anos. La decisi6n de explorar tales tecnologias, la precisi6n nen en realidad los productos que les facilitan la vida. con que se han creado las armas que son resultado de elIas, y la Desde esta perspeetiva, el dano que nuestro planeta ha ex- facilidad con la que se justifica su uso en la actualidad, y cO.Q, perimentado podrla verse como algo que en gran medida no la que algunos induso creen que es posible sobrevivir a ellas~, fue intencional, sino el produeto secundario y la consecuencia crea 10 que indudablemente es la mayor amenaza a nuestra, de nuestros cambiantes puntas de vista sobre el progreso, la supervivencia hoy en dia. economfa y nuestra relaci6n con el mundo. Ahora que se ha identificado el peligro de los productos que acaban con el medio ambiente, y que las predicciones cientfficas y las de las culturas De fa ignorancia a fa intenci6n: antiguas se han validado, podemos trabajar juntos para cam~ C6mo encontrar nuestro camino biar y "corregir los errores". Aunque esta no es una excusa que estando af borde de fa destrucci6n justifique los efectos catastr6ficos que han ocurrido (como La destrucci6n de los sistemas que apoyan la vida en nuestro, derrames de petr6leo, fusiones accidentales del nucleo de reac- planeta: los oceanos, la atm6sfera, los rIos, los lagos y los bos- . tores, explosiones en plantas quImicas y desechos t6xicos), ayu- ques, ha sido ante todo el resultado de nuestra ignorancia en el i da a distinguir con claridad la amenaza de las tragedias pasado con respecto al dano que los combustibles f6sHes y las ambientales, la credente amenaza de armas de efectos masivos sustancias qufmicas pueden causar a nuestro mundo. Aunque . y la amenaza de las ideas que llevaron a su creaci6n. siempre ha habido "personas informadas" que tienen acceso a los peligros de tecnologias especfficas, y aunque es indudable: Ef mundo sigue en guerra que el poder y la ambici6n han tenido un papd importante en la forma en que se aplican las nuevas tecnologfas, la mayoria· Para muchas personas, el final de la Guerra Fda a finales de la de la poblaci6n general no se ha dado cuenta de las consecuen"!'~ decada de 1980 marcO el principio de una paz relativa en el cias que podrfa tener el apoyar a las industrias que acaban can') mundo. Por primera vez en casi una generaci6n, la constante nuestros recursos. amenaza de una guerra nuclear pareda desaparecer y el mundo La familia norteamericana promedio que trata de eneon· \ dej6 escapar un suspiro de a1ivio cuando Estados Unidos y Ru- trar eI equilibrio entre dos carreras profesionales, juntas de sia crearon nuevas relaciones y exploraron nuevas Eormas de padres de familia y practicas de futbol, ha dejado en manos dell' trabajar juntos en la era posterior a la Guerra Fda. Aunque en gobierno y de la industria la responsabilidad de mantener ba· esa epoca no se libraron "guerras decIaradas" a escala mundial, jos los niveles de radiaci6n en las plantas nucleares y asegurar- la paz relativa era precisamente eso: relativa. Ademas de la tan se de que el agua, el vapor y los residuos de las minas y fabricas visible lucha por territorios entre Israel y Palestina en el Oriente no sean un riesgo. Como consumidores, pocas personas han Media, a finales de la decada de 1990, at menos otras 20 nacio- vista mas alIa de los anaqueles de los centros comerciales y nt's se vieron involucradas en guerras. 1O Aunque a menudo s610 224 El C6digo de Dios lOue hemos aprendido? 225 se les ha llamado "conflictos", estas hostiJidades han tenido momenta de la historia reciente, el mundo parece estar dividi· como resultado los mismos sufrimientos y las mismas victimas do en cuanto a la manera de enfrentarse a las amenazas que se que son el rasgo caracterfstico de las guerras declaradas. perciben contra los intereses nacionales, la seguridad de los Algunos de estos conflictos que han recibido poca aten- , continentes, y en el caso de paises como Israel, la superviven- cion de los medios noticiosos, brotaron de desacuerdos muy : cia misma de su estilo de vida. antiguos y han continuado durante decadas, mientras que otros~: En el contexto de un mundo de este tipo, la tecnologia se son relativamente recientes. Estos conflictos ya han cobrado ha convertido en un factor dominante en la paz mundiaL La millones de vfctimas. Para 1999, la guerra en Sudan entre los capacidad de las armas convencionales y un sofisticado arsenal musulmanes del norte y los cristianos del sur ha causado aproxi- de armas nucleares que represento una ventaja para los poderes madamente 1.9 millones de vfctimas, muchas entre la pobla- ocddentales durante gran parte del siglo pasado, es tecnologia cion civil. 11 A finales del siglo XX, casi la mitad de las guerras que ha caido en manos de quienes estos poderes consideran no declaradas del mundo se libraban . en el continence afri- {. sus enemigos. Aunque es posible que la Guerra Fda haya ter- cano, ademas de 10 que quedaba de "puntos conflictivos" como minado oficialmente a finales de la decada de 1980, las armas Bosnia, Kosovo, Macedonia, Chechenia, Azerbayan, Tajikis- que se desarroHaron a partir de la dencia de la Guerra Fda tan, Kashmir, India, Filipinas, Indonesia, Tibet y el Medio siguen estando presentes. Oriente. Desde guerras civiles y luchas por independencia, hasta purgas etnicas, el periodo que muchos percibieron como tiempo IPor que ahora? de paz, en realidad ha sido todo menos pacifico. Despues de los tragicos sucesos del 11 de septiembre de A finales de la ultima decada, se sabIa que el "club nuclear" 200 1, la amenaza del terrorismo ha concentrado la atencion (naciones que admiten oficialmente que han desarrollado y mundial en paises y ciudades que muchos occidentales nunca acumulado armas nucleares) tenia siete miembros: Estados habian escuchado nombrar antes. De pronto, regiones como Unidos, Rusia, China, Francia, Inglaterra, India y Pakistan. Kabul y Tora Bora en Mganistan se volvieron nombres fami- i Corea del Norte esta entre los paIses que activamente partici- liares, cuando las tropas estadounidenses se desplegaban en las . pan en programas para el desarrollo de armas nucleares, y po- montafias que forman la frontera con Pakistan. Apoyandose ' siblemente haya otros. En el punto critico de la Guerra Fda, el en el principio de la seguridad preventiva, en unos cuantos arsenal de armas nucleares creado entre Estados Unidos y la meses, la busqueda de terroristas se concentro en paises mu- antigua Union Sovit~tica, icomprendia casi 70,000 cabezas nu- sulmanes, y cambio el panorama de la paz mundial de una cleares dispersas en America del Norte, Europa y Asia! 13 manera sin precedente en la historia reciente. Estas estadIsticas inc1ulan armas que estaban activamente En las palabras del profesor de Harvard, Samuel P. Hun- desplegadas, al igual que las reservas para reabastecer suminis- tington, "Los ingredientes de un posible 'choque de civiliza- tros en tiempo de guerra. Despues de los tratados que se dise- clones • estan presentes " .12 Q' '.l .(, que nunca ell eua IqUler Ulza mds . flaron para reducir csa ennrme cantidad de cabezas nucleares. 226 EI C6diga de Dias lQue hemos aprendido? 227 las naciones empezaron a reducir los arsenales que podrIan mayor amenaza de guerra que en cualquier momenta de los haber destruido muchos planetas del tamano de la Tierra. Se.., Ultimos 100 anos. gun el Consejo para la Defensa de Recursos Naturales, hoy en t' Es obvio que existen las condiciones para una catastrofe dia, a principios del siglo XXI, el arsenal nuclear del planeta e8; causada par la guerra y para las muertes que sedan consecuen- aproximadamente la mitad de 10 que era en el punto cdtico de:~ cia de ella, en proporciones epicas inimaginab1es. Tambien es la Guerra Fda, con unas 36,000 cabezas nucleares. 14 Sin em- ,: claro que es virtualmente imposible prepararse y defenderse bargo, el Consejo ha informado que estas cifras no induyen i; de eada una de las multiples amenazas que se conocen. Es muy los arsenales de paises nucleares no declarados, pero que se: probable que ya existan otras amenazas en 1a coleecion mun- sabe existen, como Israel. dial de armamentos que todav{a no se han dado a conocer En una epoca en la que hay cada vez mas diferencias y una publicamente. creciente tension entre paises nucleares vecinos, la amenaza de: En eI contexro de los arsenales en constante desarrollo y la esos arsenales no puede ignorarse. Aunque despues del final', creciente tension entre las porencias mundiales, a menudo me de la Guerra Fda se inicio la desrruccion de un porcentaje de.' he pregumado: ",iPor que ahora? ~Por que ofrecer hoyeste li- armas nucleares, el proceso parece haber perdido velocidad. Ai bro que describe el mensaje de nuestras celulas?". Si alguna vez comentar esta falta de continuidad, Joseph Cirincione, Direc.. ; exploraramos eJ poder de un principio que pudiera unificar las tor del Proyecto de No-Proliferacion del Legado Carnegie para'" diversas ideas emicas, religiosas y pollticas, esta es la genera- la Paz Internacional [Non-Proliferation Project at the Carne- " cion en que deberlamos hacerlo. Ante un arsenal global de gie Endowment for International Peace] dedaro: "Una de las . armas con un poder destructivo sin precedence, yante 1a deci- cosas sorprendentes es que el desarme nuclear potencialmente' sion de utilizarlas para poner en vigor politicas que se basan en se ha detenido". Con respecto al estado actual de las armas." nuestras diferencias, este es el momento apropiado para ofre- nucleares que aun quedan en el mundo actual, Jorgen Wouters; eer el mensaje de nuestras celulas. informo al Noticiero ABC que "las potencias mas importantes " En una entrevista que Alfred Werner Ie hizo a Albert Eins- todavfa poseen mas que suficientes armas nucleares de la Gue- (ein en 1949 y que se publico en la revista LiberalJudaism, Ie rra Fna' para destrUlr . aI p Ianeta muc has vecesl> . 15 pregunto como pensaba que serian las armas de una tercera Ademas de los arsenales nucleares de las potencias que se guerra mundial en la era nuclear. Su respuesta fue un esca10- han enemistado, el numero creciente de armas qufmicas y bio- friante recordatorio del camino peligroso en el que nos encon- logicas se suman a la ya formidable amenaza de guerra que (ramos en la actualidad, al igual que de la responsabilidad que tendrfa consecuencias a nivel mundial. 16 Aunque la existencia (enemos como civilizacion para asegurarnos de que esas es- de toxinas biolOgicas y agenres quimicos disenados para la gue- pecu1aciones nunca se hagan realidad. Con 1a sencillez y el rra se declaro ilegal en los Prorocolos de Ginebra de 1925 y candor que Ie eran caracterlsticos, Einstein respondio: "No se mas tarde en fa Convencion de Armas Qulmicas [Chemical ~a­ si la Tercera Guerra Mundial se librara algllll dfa, ipero puedo pons Convention, CWC] de 1993,17 hoy en dla plantea una decir que 10 que ust"n en la ClI;uta van ;1 ser piedras!". III 228 El C6digQ de Dics ZQue hemos aprendido? 229 En los primeros anos del siglo XXI, estamo.s en una encru~, do la experiencia moderna de una lecci6n muy antigua, y una cijada peligrosa como civilizaci6n global. Ya no es una deci~ nueva oportunidad para elegir un nuevo resultado. si6n americana, rusa, china 0 europea el retroceder del bord del conflieto global. A causa de la globalizaei6n y de la difu, Lecciones de nuestro pasado si6n de la tecnologia, un conflicto en cualquier lugar del mun",> do debe eva1uarse en terminos mundiales. EI Mahabharata, que se ha Hamada el poema epico nadonal A medida que las naciones de la Tierra adoptan creenci de la India, y tambien la Biblia Hindu, es una obra literaria sin religiosas e ideas poliricas, las guerras civiles, las guerras reli , paralelo en cuanto a su extensi6n y su tema. Tambien podria giosas y las guerras econ6micas, sin importar 10 justas que pa~, ser la descripd6n de una guerra con tecnologia tan avanzada y rezean, redueen el potencial de regiones y continentes entero.~ con conseeuencias ran devastadoras, que aeeptar el relato como en formas que haee s610 un cuarto de siglo habdan sido imp<>-' un hecho hist6rico seria casi impensable. Aunque el relato anti- sibles. guo describe sobrevivienres de la ultima batalla, no hubo una Teniendo tecnolog{as que pueden incapacitar a los ejerci, victoria real. EI predo que pagaron las sociedades en guerra tos mas capaces, causar destrozos en la base misma de la vida, que describe el Mahabharata, tuvo como resultado una des- destruir dudades y naciones y acabar con poblaciones emerasii trued6n de proporciones biblicas, incIuyendo la perdida de el futuro de nuestra especie depende ahora de la habilidad co"'! innumerables vidas, la esterilidad de la tierra y la destrucd6n lectiva para superar nuestras diferencias. En 10 que podrfa lIe, de una dvilizaci6n avanzada que data de antes de la historia. gar a ser una gran ironIa de la historia humana, un credent ' El relato se escribi6 originalmente en el antiguo lenguaje corpus de evidenda sugiere que esta tal vez no es la primer " sanscrito, haee de 2500 a 3000 anos. Contiene aproximada- vez que la humanidad se ha enfrentado ala posibilidad de s' mente 100,000 versos y e1 cerna central del poema epico es propia destrucci6n con el uso de armas que rienen el poder d ' una lucha entre dos reyes, el Rey Pandu y el Rey Dhritarash- eliminar civilizaciones enteras de la faz de la Tierra. ' tra, que termin6 en una gran batalla que pudo haber ocurrido Aunque no se reeonoce en la historia eonvencional, algu... haee de 8000 a 10,000 aiios; jmucho antes de epocas en que la nos de los registros mas antiguos de nuestro pasado detall ' hisroria tradicional registra la existencia de grandes eivilizado- precisameme un escenario de ese tipo, y la batalla que aca nes y tecnologia sofisticada! Es interesante que la ultima bata- con dos vastos imperios en una epoca antes del inicio de 1 lla que se describe en el Mahabharata, tambien haya marcado historia. Un credente corpus de evidencia arqueo16gica que el fin del ultimo cicIo de la cosmologia hindu, el DvuparaJuga, considera an6mala en los estudios tradicionales, muestra indi': yel principio de la ultima gran era del mundo. Vivimos en esa cios de que al menos algunos de los documentos podrfan ser era actualmente, el tiempo de Kali Yuga. los lHtimos rastros de hechos hist6ricos reales. Si escos hechos La descripci6n de armas y t:kticas de guerra que eneomra- ocurrieron, entonces hoy en dfa podriamos estar contemplan- mos en e1 poema epico hindu ha captado el interes de historia- 230 El COdigo de Dios lQue hemos aprendido? 231 dores y generales en e1 pasado. Esas mismas descripc~ones estan guerra, la posibilidad de una catastrofe de tal magnitud se con- ahora captando la atencion de cientificos e investigadores. S , virti6 en una realidad moderna. desarrolla en los valles cercanos a 10 que en la actualidad e La relaci6n en~re la catastrofica batalla del Mahabharata y Delhi, India; los versos del Mahabharata detallan el uso de u el poder de la devastaci6n nuclear no ha pasado sin ser notada arma que causa la total destrucci6n de grandes reglones de', en tiempos recientes. Despues de la detonaci6n exitosa de la Tierra y de roda la vida que las habitaba. El arma misteriosa. primera bomba at6mica del mundo en el campo de pruebas introduce y se descarga en la batalla, se Ie describe como un: de Trinidad en 1945, eI Hsico Robert Oppenheimer cit6 direc- "arma desconocida, e1 relampago de hierro... un solo proyecti), ramente al Bhagavad-Gira, una porci6n del Mahabharata. Re- con todo el poder del universo". 19 El impacto tuvo como reo- firiendose al papd de creador y destructor que tiene el Dios sultado "una columna incandescente de humo y fuego, t hindu Shiva, Oppenheimer cit6 la declaracion de Shiva toma- brillante como 10,000 soles.. ."2o da del poema epico al contemplar la furia de la explosion: ''Aho- Los versos describen la rotal devastaci6n qu~ el arma dej ra he muerto, yo el destructor de los mundos".24 tras de sf. "La Tierra temblo, quemada por el terrible calor d Es interesante que ademas del poema epico de la India, arma. Los defantes ardieron en llamas... En una enorme re'''; algunas orras culturas antiguas, incluyendo las de los nativos gi6n, los animales cayeron al suelo y murieron. Las aguas hell, de America del Norte y los Dzyan del Tibet, describen una 2 vian, y las criaturas que vivian en elias tambien murieron". ., epoca de gran destrucci6n en nuestro pasado. Cada una atri- En los Ultimos sucesos de la batalla, el texto describe el horci" buye la devastaci6n que result6 de ella a una lucha entre el ble destino de los seres humanos atrapados en la senda de t bien y el mal y a la lucha de la humanidad por alcanzar destruccion. "Los cadaveres estaban tan quemados que e roder. (Serfa posible que en un periodo de nuestro pasado imposible reconocerlos. EI pelo y las uiias se les cayeron".~ remoto, hayan existido en la Tierra tecnologfas nucleares, Detalles adidonales describen c6mo "las vasijas se rompiatt incluyendo las que se construyen para la guerra? (Podrfa una sin causa. Las aves, perturbadas, volaban en drculos y se vol~, civilizaci6n avanzada haber ascendido en la escala de la evo- . vleron bl ancas. " 23 luei6n tecnol6gica miles de afios antes del inicio de la historia Si la tecnologia que se describe aqui y sus efectos fueran convencional, s610 para desintegrarse en las ruinas de su pro- relatos exactos de 10 que ocurri6 hace muchlsimo tiempo, ob., pia destruccion? viamente se trata de un arma que no se parece a nada de 10 que,.; Un creciente corpus de evidencia, y un credente numero segun se sabe haya existido en ninguna epoca de la historia; es de ciendficos, esnin empezando a considerar con seriedad es- decir, hasta que se introdujeron armas at6micas en el mundo a las preguntas. Ya en 1909, cuando los ciendficos empezaban a medlados del siglo XX. Hasta hace poco, la magnitud de la', t'ntender el poder que podda desatarse del atomo, el flsico destrucci6n que se describe en los versos del Mahabharata era Frederick Soddy, comento: "Creo que han existido civiJiUl- inconcebible como efecto de una sola arma. No obstante, al dones en el pasado que conodan la energia at6mica. y que par detonarse, en 1945 la primera bomba nuclear que se useS en la d mal usa que hideron de ella fueron totalmente dcsrruidas".l' 232 El C6digo de Dios lQue hemos aprendido? 233 Si en realidad una civilizaci6n antigua poseyq Ia ciencia y la. traducido ni desdfrado. AI no poder leer 10 que sus habitantes tecnologia para dominar el poder del aromo, y de hecho Ia usQj dejaron tras de si, s610 contamos con los artefactos fisicos para en la guerra, deberiamos ver hoy en dia evidencias de la destrucci6n: conocer la historia de Harappa y Mohenjo Daro. resultante. Aunque por todo el mundo se han recibido inform ! Tal vez el mayor misterio que nos dejan las ciudades anti- de descubrimientos an6malos como cumbres de montafias qu~ guas es par que se olvidaron. ~Que causo su abandono? Los des- madas, arena de antiguos desiertos fusionada como grand,' cubrimientos de Wheeler podrian darnos cierro indicio. Cuando placas de vidrio, y antiguos esqueleros radioactivos,26 qui . la excavaci6n lleg6 al nivel de las antiguas calles, los trabajado- los hallazgos mas elocuentes se escan excavando cerca del le~. res encontraron varios esqueletos humanos contorsionados y gendario sitio de la batalla que se describe en el Mahabharat/4 en posturas extranas; algunos de ellos todav{a estaban torna- A principios del siglo XX, los arque610gos empezaron . dos de las manos, como si algun desastre inesperado los hubie- excavar los resros de una civilizaci6n desconocida en el vall ra sorprendido. Los informes sobre otras excavaciones en el del rio Indus, en el norte de la India y Pakistan. Aunque ., area describen los hallazgos: "En algunos sitios, se encontra- sabia que rribus n6madas habian habitado esa zona durant , ron en las escalinaras grupos de esqueletos en posturas que miles de anos, estudios historicos habian vinculado un desa'fl indican que estaban huyendo".z9 ~Que les paso a estas perso- rrollo organizado en esa region a las invasiones arias en el and. nas, y por que sus esque1eros estan tan inractos? ~Que circuns- 1500 antes de nuestra era. Con el descubrimiento de dos cillo:'': tancias impidieron que los animales salvajes, el deterioro 0 los dades importantes, Harappa y Mohenjo Daro, esa fecha se fijd saqueadores movieran los cuerpos despues de su muerte? en el ano 3000 antes de nuestra era. { Tal vez la respuesta a estas preguntas este en descubrimien- El arque610go bridnico Sir John Marshall, excav6 la anti~ tos que recibieron menos publicidad de esqueleros similares gua ciudad de Mohenjo Daro por primera vez en la decada encontrados cerca de la ciudad actual de Delhi. AI hacer las 1920, Yposteriormente, en 1946.27' 28 S'lr M' ortlmer Wh eel' et, excavaciones preparatorias a la construccion de un complejo Ilevo a cabo mas excavaciones. Estas revelaron un centro urba, habitacional, los trabajadores informaron haber encontrado no excepcionalmente bien planificado, con una sofisticaci6.ti, algo que no deberia haber estado alIi. En una zona en la que ya que no se ve en muchas de las dudades y aldeas de nuestrO$i se habia detectado un nilmero alarmante de casos de cancer y dias. Los arquitecros de Mohenjo Daro construyeron su ciu: defectos congenitos, descubrieron una gruesa capa de ceniza dad siguiendo un plano cuadrado definido par avenidas de 10, radiactiva bajo la superflcie de la tierra. 3D metros de ancho. Muchas de las estructuras tenian agua co.. Investigaciones posteriores revelaron que la ceniza cubda rriente y sistemas cerrados de drenaje, al igual que grandes un area de aproximadamente tres millas cuadradas (a modo de areas cerradas que se cree eran banos pilblicos 0 rituales. Ade- comparaci6n, la zona de devastacion mas grande en la ciudad mas del diseno avanzado de las ciudades, los habitantes del japonesa de Hiroshima cubri6 aproximadamente cuatro mi- Indus utilizaban una forma de escritura ahora oIvidada que se lias cuadradas). En su libro Riddles ofAncient History [Acertijos conoce como Escritura del Valle del Indus, que nunca se ha tit' fa historia antigual. d arque610go ruso A. Gorbovsky dice • 234 El C6digo de Dios lQue hemos aprendido? 235 que se encontr6 al menos un esqueleto hum,ano en esa zona· perspectivas conflictivas sobre 10 que significa la palabra p'" icon un nivel de radioactividad aproximadamente 50 veces.· greso dividan al mundo de manera aparentememe irreconcilia- mayor que el que deberia haber tenido a causa de radiaci6n, ble? Al considerar el poder destructivo de los arsenales nucleara. naturaH 31 (Que podrCa explicar estoS hallazgos "an6malos" de, quimicos y biol6gicos que hay en el mundo, ~podemos permi- una civilizaci6n que Ueg6 a la cumbre y luego pereci6 casi 2000, timos el riesgo de no encantrar la respuesta a esa pregunta? alios antes del tiempo de Jesus de Nazareth? '. La historia ha demostrado que en el Fragor del conflicto, e1 Es obvio que todavfa debe llevarse a cabo mucha investiga:-: "pader" a menudo se convierte en una justificaci6n para el usa ci6n adicional en este sitio y otros similares. A partir de ella,' de cualquier medio que se considere necesario para proteger podremos confirmar los hallazgos y desentraliar los secretos., ( valares y creencias profundamente arraigadas. EI Mahabha",· que plantean para nosotros esos restos. Incluso sin haberse rea- : ta es la historia de una paderosa arma letal, usada como ulti- lizado un estudio espedfico, estos hallazgos contribuyen a un I mo recurso, por un ejercito que crcia que si no salfa victorioso creciente corpus de evidencia que indica que algo sucedi6 haee: de la batalla perderia su civilizaci6n y su estilo de vida. Si en la mucho tiempo que tuvO efeetos tan devastadores que toda una,{ actualidad se manifestara un escenario similar, las generacio- civilizaci6n desapareci6. nes futuras podrfan leer sabre nuestra epoca en un poema epi- (Los descubrimientos de Wheeler, Marshall y otros reve- co sobre la gran guerra del siglo XXI, justificada por creendas Ian la evidencia y las repercusiones de una civilizaci6n avanza-! similares. Si la literatura de la India es de hecho un registro da y de su incapacidad para sobrevivir a su "adolescencia.; exacro de sucesos hist6ricos, entonces la humanidad ha expc· tecno16gica"? Los efectos de una explosi6n nuclear estan muy, rimentado las consecuendas de esta manera de pensar en d bien documentados en la actualidad. Con la similitud entre, pasado, y dificilmente sobrevivi6 a elIas. La pr6xima vez po- esos efectos y los hallazgos en estos sidos antiguos, los parale"",' defamos no ser tan afortunados. los son claros, y las comparaciones inevitables. Cuando com"i En ocasiones se pasa por alto la simplicidad del origen de binamos la evidencia tangible de hoy con los escritos del pasado" 10 que parecen ser los muchos y complejos temas de donde surge en nuestra mente una pregunta; Si como humanidad, Y8\i brotan los problemas mundiales hoy en dia. La Fuente de la hemos seguido la senda de autodestrucci6n y hemos acabado, mayor amenaza a nuestra supervivenda es la forma en que con toda una civilizaci6n por el mal uso del poder, ~estamos,' perdbimos nuestra diversidad. La mayoria de los conflictos en peligro de cometer de nuevo e1 mismo error? actuales se basan en diferencias entre los pueblos, las razas, las Al alinearse las naciones una contra otra debido a antiguas religiones y las creencias. Algo real 0 que puede percibirse, es luchas relacionadas con territorios, linajes y creencias religio- que en el siglo XXI, reconocer un principio unico que tras- sas y politicas, (es posible que esas difereneias Heven al mundo cienda nuesrras diferencias, unificando a personas de todas las a otro conflicto global en nuestra epoca? ~Permitiremos que creencias y profesiones, Sf convierte en un elemento estraregi- las diferencias entre el capitalismo y el socialismo; la diversi- co al igual que en una comprensi6n espiritual. La naturalcza dad entre los valores cristianos, hebreos y musulmanes; y las universal del hecho de 'IUt' (.'1 nornbre de Dios se manifiesre en - - - -........ ~ 236 El C6digo de Dios lQue hemos aprendido? 237 las celulas de nuestro cuetpo podtia lIegat a St;t el fundamento agrado. Los diarios de los colonizadores de Jamestown, Virgi- de ese ptincipio. nia, que fue el primer asentamiento permanente de europeos en America del Norte, atribuyen su supervivencia al devasta- Mas aUa de nuestras diferencias: dor inviemo de 1607 a 1608, un inviemo para el que no es- Supervivencia a traves de la unidad taban preparados, a los consejos y el apoyo de los nativos que los ayudaron. La histotia y las experiencias de quienes nos han ptecedido Sin embargo, pronto fue obvio que los dos estilos de vida pueden en ocasiones ser nuestros mejores maestros en 10 que eran incompatibles; el estilo de vida de los nativos nunca podria concieme a como procedet cuando enttemos al tettitorio inex- sobrevivir a la vision del mundo de los europeos. Para las co- plorado de las ideas nuevas. Aunque los tiempos han cambia- munidades indigenas que habian equilibrado con exito las ne- do y ahora contamos con factores de ciencia y tecnologia que cesidades de la vida diaria con los ciclos de la naturaleza durante nuestros antepasados no podian siquiera imaginar hace 100 cientos de afios, la sola idea de que la tierra pudiera reclamarse afios, en muchos aspectos los principios de enfrentar los cam- como propia era tan inconcebible como la idea de la propie- bios son los mismos. dad del aire que los rodeaba y de la lIuvia de los cielos. Como Ya sea que hablemos de las comunidades de nativos de Norte el concepto de que la naturaleza podia "poseerse" era tan ilogi- America que trataban de preservar su estilo de vida en el siglo ca, muchos nativos no tomaron en serio la amenaza que repre- XVII, 0 de nuestra familia global que trata de sobrevivir a las ' sentaban los colonos europeos. Simplemente no entendian 10 amenazas del siglo XXI, en los niveles mas basicos, la expe- que les estaba pasando a ellos y a su cultura. riencia es la misma: estamos hablando de homar la vida. Una . No obstante, un pufiado de Iideres de esas tribus empezo a de las mayores lecciones de la historia nos ha ensefiado que fa uni- , comprender gradualmente la naturaleza de la inminente ame- dad y fa cooperaci6n ofrecen una mayor oportunidad de supervi- '. naza. Aunque es posible que estos visionarios no comprendie- vencia de fa que alguna vezpodria lograrse mediante competencias ran plenamente las intenciones de los colonos que lIegaban a y conflictos. sus tiettas, si reconodan que las diversas tribus tenian que co- operar y unificar su voz para preservar su estilo de vida 0 se DURANTE LA COLONlZACr6N DE AMERICA DEL NORTE por los ' perdetia para siempre. jSabian que su supervivencia depende- europeos, las comunidades indigenas que habian sido indife- ria de su habilidad para hacer eso! Pero lamentablemente, cuan- rentes y en ocasiones hostiles hacia sus vecinos, vislumbraron do los Iideres fueron testigos de las consecuencias de que sus muy bien la necesidad de superar sus dificultades. Cuando los comunidades no fueran capaces de unificarse, organizarse y primeros exploradores y colonizadores lIegaron a las ~ostas de :lctuar, ya era demasiado tarde. 10 que en la actualidad es el noreste de Estados Umdos, las Quiza uno de los ejemplos mas desgattadores de esa lec- tribus y las familias que habian vivido en esas zonas durante cion de unificaci6n para el mayor bien, son los relatos de la muchas generaciones, par 10 general los recibieron de buen tribll Narragansett y de SII Iider eI Jefe Miantonomo. El jefe 238 El C6digo de Dias lQue heroos aprendido? 239 reconoci6 que la amenaza que representaba la calonizaci6n de . 10 ejecutaron, siendo los ingleses los testigos que confirmaron Norteamerica iba mas alIa de los miembros de su tribu, y se . el castigo. extendfa a las tribus vecinas, con las cuales 5U tribu habfa teni· . Este relaro ilustra la urgente necesidad de hacer a un lado do conflictos y tensiones en el pasado. Se puso en contacto nuestras diferencias individuales y unificarnos ante una ame- con los pueblos Mohawk y propuso una alianza para crear 10.' naza comtin. Aunque no existe garantia de que el genocidio de que el historiador Ian K. Steele ha Hamado "un movimientG' aproximadamente 20 millones de nativos norteamericanos pu- unificado de resi5tencia amerindia" 32 Se dice que en 1642, el diera haher sido diferente, existe la posibilidad de que un es- jefe dijo: fuerzo combinado de los nativos durante los primeros alios de la colonizacion habrla marcado una diferencia en cuanto a fa forma en que esta se llev6 a cabo. Es includable que fa coloni- Debemos ser uno como los ingleses, de 10 contrario desapare- zaci6n de America del Norte se hahda realizado, a pesar de ceremos dentro de poco, pues como ustedes saben, nues- los esfuerzos a favor de los habitames originates. La ola de des- tros padres tenian muchos ciervos y pides, miestros campos contento que invadi6 a Europa en el siglo XVII y la tecnologia y bosques estaban Henos de ciervos y de pavos, y nuestros que permiti6la colonizaci6n del "Nuevo Mundo", gener6 un lagos Henos de peces yaves. Pero estos ingleses, al apoderar- dinamismo que no habrfa sido posible detener. se de nuesrra tierra, cortan los pastos can sus guadanas y los Sin embargo, la forma en que ocurrio y se desarro1l6 po- arboles con sus hachas; sus vacas y caballos comen el pasta drfa haher sido orra si se hubiera tornado en cuenta la pre- y sus cerdos echan a perder las playas donde viven nuestras sencia de los 50,000 habirantes nativos de Virginia en 1607. almejas. Nos vamos a morir de hambre [el aurar anadi61as Respaldados por la fuerza de su numerosa pohlaci6n, de su italicas].33 conocimiento sobre como sobrevivir en la tierra "nueva", y con eI poder de una sola voz, es posible que los pueblos nativos Desafortunadamente, otra leccion de Ia hisroria nos mues··i., hubieran persuadido a los colonos a trabajar con elIos y no tra como los esfuerzos bienintencionados en un area de la vid contra eIlos, en cuama a la forma en que se lIev6 a cabo la co- no siempre resuelven los problemas en orras areas. Durante 1..) lonizacion. guerra entre las trihus que se estaba librando al mismo tiempoi Debido a luchas entre las tribus ya diferencias de opinion, que los indios perdfan su estilo de vida ante los europeos, el de vala res y de metas, no se formo a tiempo una voz unificada. Jefe Miantonomo fue capturado por miemhros de la trihu. Para cuando las tribus de America del Norte se dieron cuenta Mohegan quienes 10 pusieron bajo la custodia de los ingleses.· de 10 que Ie estaba ocurriendo a su estilo de vida, estaban tan como "rebelde". Pero como este problema no estaba dentro de debilitados par enfermedades introducidas par los europeos, la jurisdicci6n de las Colonias Brininicas, los ingleses pensa- como la viruela, y tan ahrumados por armas avanzadas como ron que no tenfan derecho legal para juzgar 5U caso. Como rifles y artilleria (al igual que por los caballos, carretas y fuer- soluci6n. pusieron al jefe en manos de la Trihu Unca. quienes tes), que 10 unico que pudieron hacer fue resistir. 240 El C6digo de Dias lQue heroas aprendida? 241 Aqui la clave es que al no ser capaces de sobreponerse a sus , La naturafeza: diferencias locales y unificarse en nombre del bien comun, los': Modelo de unidad y cooperaci6n habitantes originales de Norteamerica perdieron 10 que ama-; Aunque la teoria de la evoluci6n en s1 ha sido objeto de fuertes ban y consideraban valioso: su cultura, la tierra que habian" criticas, las observaciones hechas por Darwin al desarrollar su servido durante cientos de generaciones, y finalmente, gran: reoria se han converddo en ejemplos dasicos de estudios sobre parte de su estilo de vida. Aunque ya muy tarde, la realidad de; el comportamiento social. Aunque las espeeies son diferentes, esta tragedia se reconoce en la actualidad. Ahora se esta restau":ll , los prineipios son similares en los insecros, los animales y los rando 10 que aun queda de este estilo de vida tan vasto y anti..:, humanos. A diferencia de la conclusi6n que Darwin parece guo, y se esta preservando en los territorios mas pristinos, rudoS:, haber sacado sabre la fuerza y la supervivencia en Elorigen de y hermosos que rodavia quedan en Norteamerica. Ademas, un; las especies, sus obras posteriores describieran estrategias de su- creciente numero de personas que no estan satisfechas con las:: pervivencia basadas en la unidad y la cooperaci6n mas que en formas convencionales de medicina, de culto y de estilo dc< "la supervivencia del mas apto". En su siguiente libra, La des- vida, se estan acercando a las eostumbres antiguas considera"'; cendencia del hombre, Darwin resumi6 estas observaciones di- das sagradas por los primeros habitantes de America. ciendo: "Las comunidades que indufan el mayor numero de La historia del Jefe Miantonomo y la eolonizacion inicial,. miembros simpatizantes floredan mejor y tenlan mayor des- de Estados Unidos es s610 una de muehas historias que po-~ '''34 cendenCla . drian eontarse. La raz6n para ofreeer este ejemplo en particu.., A principios del siglo XX, el naturalista ruso Peter Kropo- lar es que ilustra en forma grafica una poderosa lecci6n d~ tkin refono las ultimas obras de Darwin con sus observacio- supervivencia de la que podemos aprender hoy. La lecci6n es nes, ilustrando como habia encontrado que la cooperaci6n y simplemente esta: Para la supervivencia de su grupo, a lasi~ la unidad eran las claves del exiro y la supervivencia de una familias, comunidades y naciones les conviene ver mas alia' especie. En su libra Ayuda mutua: un factor de evolution, Kro- de las diferencias que amenazan su estilo de vida y trabajar~ porkin describe con elocuenda los beneficios que experimenra en cooperaci6n para superar aquello que amenaza su exis.-',. el reino de los insectos debido ala capaeidad instintiva de las tenela. , hormigas para vivir en sociedades de cooperaci6n, no de com- El mismo principio podria apliearse a mayor escala a todo , petenCla. el planeta. Aunque esta observaci6n podria parecer obvia a nivel' intuitivo, la historia esta llena de ejemplos en los que no sc Sus maravillosos nidos, sus construcciones, superiores en reconoci6 este principio tan fundamental de supervivencia. camano relativo a las del hombre; sus caminos pavimenta- Ademas de que pareee apoyarse en el sentido comun, vemos· dos y sus galerias subtemi.neas abovedadasi sus espaciosos evideneia directa del poder de la unidad y la cooperaci6n en salones y graneros; sus campos de cultivo, sus metodos de ejemplos tornados de otras especies. cosechar y "cuhiv.u" sl'millas; sus rnetodos racionales para 242 El C6digo de Dios laue hemos aprendido? 243 cuidar de sus huevecillos y larvas y de con~truir nidos espe:" pectivas dases, el desarrollo mas alto de inteligencia y de orga- ciales para criar a los afidos que Linneaus describe pintores- nizadon corporal". 38 camente como "las vacas de las hormigas"; y finalmente su Posteriormente en el mismo discurso, Logan dto la obra valentia, animo e inteligencia superior... todas estas cuali- de Alfie Kohn (No Contest: The Case Against Competition (Sin dades son el resultado natural de la ayuda mutua que prac- pugna: el argumento contra la competenciaJ), describiendo cla- dcan en todas las etapas de su vida laboriosa. 35 ramente 10 que reveiaron sus investigaciones sobre el grade de competencia que es benefico para los grupos. Despues de ana- EI Dr. John Swomley, profesor emerito de etica social en la' lizar 400 estudios sobre la cooperaci6n y la competencia, Kohn Escuela de Teologia de St. Paul, en Kansas City, deja en claro! Ilego a esta conclusion: "La cantidad ideal de competencia... que nos conviene encontrar formas padficas y de cooperaci6n en cualquier entorno, el salon de clase, el centro de trabajo, la para construir las sociedades globales de nuestro futuro. Ci- familia, el campo de juego, es cero... Competir· siempre es des- tando la evidencia presentada por Krop<?tkin y orros, Swomley tructivo" (Noetic Sciences Review, primavera de 1990).39 afirma que la razon de insistir eh la cooperacion mas que en la, Se reconoce ampliamente que la naturaleza es un terreno competencia es mas que un simple beneficio de una sociedad, de pruebas para experimentos sobre unidad, cooperacion y su- prospera. De manera sendlla y directa, afirma que la coopera-! pervivencia entre los insectos y los animales. A partir de las don es "el factor clave en la evolucion y en la supervivencia" .36; lecciones de la naturaleza, se nos muestra, sin lugar a dudas, En un articulo publicado en febrero de 2000, Swomley cita a: que la unidad y la cooperacion son venrajosas para los seres Kropotkin, quien dice que la competencia dentro de una es- vivientes. Estas estrategias, corroboradas por el tiempo y to- pede "siempre dafia a la especie. Se crean mejores condiciones~ madas del mundo que nos rodea, poddan a la larga guiarnos a al eliminar la competencia mediante ayuda mutua y apoyo un modelo a seguir para nuestra propia supervivencia. Sin mutuo".37 embargo, para aplicar una estrategia de este tipo, debe tomar- En el discurso introductorio del Simposio sobre Aspecro'! se en cuenta otro factor que existe en nuestro mundo y no esta Humanisticos y Desarrollo Regional, que se llevo a cabo e~ presente en el mundo animaL Como individuos y como espe- Birobidzhan, Rusia en 1993, Ronald Logan, co-presidente d cie, por 10 general debemos saber "a donde vamos" y 10 que simposio, presento el fundamento para que los participantel podemos esperar cuando lleguemos alIi. Antes de cambiar vieran a la naturaleza como el modelo de las sociedades pr6s- nuestro estilo de vida, necesitamos saber que el resultado vale peras. En una referenda directa a Kropotkin, declar6: "Si Ie. 13 pena y que tenemos algo a que aspirar. preguntamos a la naturaleza: '~quienes son los mas aptos, los que siempre estan en guerra unos con orros, 0 los que se apo- Un futuro en el que podamos creer Yan entre sf?', de inmediato vemos que los animales que ad- quieren habitos de ayuda mutua son sin duda los mas aptos. Algunos de los ciendficos, futuristas y visionarios mas brillan- Tienen mas oportunidades de sobrevivir, y alcanzan en sus res- tcS de nuestros tiempos han especulado sobre 10 que logra- 244 El C6digo de Dios lQue hemos aprendido? 245 damos como especie si continuaramos al ritmo ~ctual de avance la naturaleza como Fuentes de energia. Clasifica eI grade de tecnologico ininterrumpido durante decadas 0 induso siglos. tales logros en un amplio esquema que se basa en tres niveles Aunque cada vision es diferente, todos pronostican una que eillama civilizaciones Tipo I, Tipo II y Tipo III. 40 Las ca- epoca en que las condiciones que han causado los mayores racreristicas clave que identifican cada ripo de civilizaci6n se sufrimientos a la humanidad sean solo recuerdos del pasado.' basan en la cantidad de energia que consumen y la Fuente de Ven un mundo en desarrollo donde las enfermedades se han su energia. La diferenda en el consumo de energia de cada eliminado, donde los periodos de vida se miden en dentos de tipo es aproximadamente diez billones de veces mas que el afios, y donde incluso la inmortalidad es posible. Nos yen evo~' nivel anterior, y esa diferencia puede "superarse" en periodos ludonando para convertirnos en una especie interplanecaria t relativamente COrtos. galactica, donde los viajes espaciales, los viajes en el tiemp En este esquema sencillo y directo, Kardashev contempla y tecnologia al estilo de Star Trek son habiruales. Casi a niv : civilizadones que) desde una perspectiva global, superan su universal, estos futuristas consideran los aspectos mas oscuro . adolescenda tecno16gica, las guerras y las inevitables diferen- del mundo como obstaculos temporales, escalones que deben: cias, de tal manera que no se destruyan a sf mismas durante subirse y que nos llevan a la epoca que enos han vislumbrado. largos periodos. Esos enormes lapsos de tiempo permiten la En su libro Visiones, Michio Kaku describe su perspecti longevidad de las civilizaciones cuya duraci6n podria medirse de 10 que nuestro futuro podria ofrecernos como planeta. en periodos de miles de ailos, no de dentos de afios. partir de las entrevistas que hizo a mas de 150 cientIficos Kardashev describe el primer nivel de progreso como civi- diferentes campos a 10 largo de un pedodo de diez ailos, Kaklt lizaci6n Tipo 1. La caracterlstica que la define es que han do- describe una era de posibilidades que parece tan fanrastica q minado los poderes de la naturaleza y toman su energia del es casi demasiado buena para ser verdad. AI mismo tiempoi planeta mismo. Utilizando el oceano, el viento y las tecnolo- advierte que un fururo de suministros ilimitados de energia gias de las profundidades de 1a tierra, trascienden las Iimitado- de inmortalidad, de cooperacion global y de viajes en "worJllil nes de los combustibles derivados de f6siles y los riesgos y holes" [un tipo de estructura que algunos dentificos creen quO peligros de las economias impulsadas por energia nuclear. Los podria existir, y que conecta partes del espacio y tiempo q1.Dl:' vastos suministros de energia que estan disponibles para la ci- normalmente no estan conectadas}, solo es posible si sobrevi ' vilizaci6n Tipo I eliminan la necesidad de competir 0 de pe- vimos ala presente crisis de las economfas basadas en combus.. lear en guerras debido a fuentes limitadas de combustibles. AI tibles extra£dos de fosiles y a la tendenda a usar la tecnologla mismo tiempo, su teenologia haee que la energia para las ne- para nuestra destruccion. cesidades basicas de la vida este ampliamente disponible para Para propordonar un marco de referencia sobre como sc una poblaci6n que se supone esta en crecimiento. desenvolveria ese futuro, Kaku habla del intento del astr6no- Las civilizaeiones Tipo 1I se caracrerizan por su capaddad mo ruso, Nikolai Kardashev, de dasificar el desarrollo de las para llegar mas alia de su propio planeta y tomar energ{a del civilizaciones por su capacidad para dominae los elementos de sol mas eereano. Habiendo logrado periodos de vida mas lar- El C6digo de Dios lOw~ hemos aprendido? 247 246 gos, los requerimienros de energfa de las civilizaciones Tipo II . La clave para alcanzar tales niveles de avance los obligarin a salir del planeta en busca de suministros nuevos es vivir a traves del presente. e ilimitados de energfa. Dominar la energfa de su sol requeri- . Debemos sobrevivir a nuestra curva de aprendizaje ria tecnologfas mas sofisticadas que la de colectar pasivamenre y encontrar la manera de superar las diftrencias sus rayos, como 10 hacemos hoy en dfa. Algunos teoricos su- , que nos han separado en el pasado. gieren que como eivilizaci6n Tipo II, viajariamos activamenre al sol con colectores que reflejan cantidades masivas de radia- Dentro de este esquema de dasificaci6n, la humanidad tiene cion solar a eiertos lugares de la Tierra, disefiados para conver- que alcanzar al menos el primer nivel, ila civilizaci6n Tipo I! tirla en energfa utilizable. Basandonos en las condiciones de nuestro mundo yen el de- Enrre los benefieios que disfrutaria una eivilizaei6n Tipo, sarrollo de la ciencia y la tecnologfa. a principios del siglo XXI II, Kaku describe un mundo que ya no es vulnerable anre las. se nos dasifica como una civilizaci6n Tipo O. Todavfa tenemos fuerzas de la naturaleza. Con la tecnologfiJ. para regular el di. combustibles derivados de f6siles, cuyo uso amenaza a nues- rna y hacer ajustes planetarios, la longevidad de esa eiviliza- tro medio ambiente. Al mismo tiempo, el hecho de poseer ci6n permitida que se llevaran a cabo preparativos que' estos combustibles ha definido ala poblaci6n de nuestro mundo involucraran eidos planetarios que duradan siglos. como los que "tienen" y los que "no tienen", y ha justificado Los avances mas sofisticados que se describen en el esque.. todo tipo de conflictos a 10 largo de gran parte de la era indus- rna de dasificaci6n de Kardashev son los de las eivilizaciones: trializada. Tipo III. Habiendo avanzado mas alia del tipo de energfa qu .. Una caracteristica de las civilizaciones Tipo 0 es su incapa- se toma del propio sol, una eivilizaei6n Tipo III se expande e cidad para unir sus conocimientos colectivos formando una su busqueda de energfa haeia otras estrellas, y quizas induso" sabiduda que beneficie a la especie como tal. Como 10 expresa llegue al material de que esta hecha la galaxia en sf, al expan. Kaku: "En la Tierra, todavfa somos una civilizaci6n Tipo 0: dirse y convertirse en una civilizaei6n galactica. En la visi6n d todavfa estamos irremediablemenre fracturados en naciones Kaku, la eieneia de una civilizaei6n Tipo III podda indusCJ pendencieras y celosas, y profundamente divididos segun dominar la evasiva energla Planck, 10 que permitida la apertu..; posturas raciales. religiosas y nacionales". 41 Como un rayo de ra del espacioltiempo para crear vfas corras enrre las estrellas y esperanza, identifica una tendencia adieional que se esta cons- galaxias mediante wormholes. Tanto la vida como la civiliza-' rruyendo en nuestro tiempo. AI enfrentarnos a guerras civiles, ci6n sedan inmortales, habiendo superado las limitaciones del <'micas y religiosas, estamos dependiendo cada vez mas unos deterioro "natural" y la posibilidad de que fen6menos "al azar" de otras mediante la globalizaei6n de las economfas mundia- puedan destruirlos. A pesar de 10 fanrasticos que parecen hoy les. EI cita la formaci6n de organizaciones comerciales, como estos escenarios, muchos cientfficos, investigadores y visiona- la Uni6n Europea, como evidencia de esta tendencia. rios creen que tales tecnologfas y futuros no s610 son posibles. iA d6nde nos lIevar:!n estas tendencias? En un senrido muy sino que son nuestro destino. leal, la respuesta a esa pre~unta se est:! creando en este mo- 248 El C6digo de Dios lQue hemos aprendido? 249 memo, a medida que buscamos nuevas forma;> de salvar nues-' za a traves de armas y tecnologia, sin emender plena- tras diferencias y unir nuestras creencias sobre el aspecto que mente las consecuencias de hacerlo. debeda tener nuestro mundo. • La ecuacion de Drake calcula que se podrian haber Si los logros de los ultimos 200 afros son una indicacion desarrollado unas 10,000 civilizaciones inteligemes 10 que es posible para nuestra especie, emonces el futuro cier~ a 10 largo de la historia de nuestro universo, que se tamente tiene una promesa que en la actualidad muchos sol·· extiende de 13 a 14 mil millones de afros. Muchos pueden imaginar en sus suefros. La clave para superar los sufri:: se preguntan: iDonde escan esas civilizaciones? Carl miemos y las tragedias que parecen prevalecer, es que debem, Sagan especulo que tal vez no hayan sobrevivido a su vivir 10 suficieme para construir el mundo que tantos han vis~ adolescencia tecnologica. lumbrado. Debemos sobrevivir a 10 que tal vez es el periodo d mayores cambios que nuestra especie haya experimentado ja • iIndican los descubrimientos arqueologicos de una mas. Debemos cooperar y salvar nuestras .diferencias. Dentr gran ciudad que data de hace ocho mil a doce mil de cada celula viviente de cada vida se preserva el mensaje q afros, que existio en la Tierra una civilizacion avan- nos da una razon para creer en nuestro futuro, y la clave p zada antes de que se iniciara la historia? iLos restos salvar las diferencias que haran posible esas civilizaciones de esqueletos humanos radiactivos, vasijas derretidas turas. y arena fundida y convertida en vidrio apoya la teo- Quizas la aurora y visionaria Jean Houston describe mej ria de que esta civilizacion se destruyo con armas ato- la magnitud de nuestra epoca historica. AI hablar del grade micas, como 10 sugiere la gran batalla descrita en el los cambios que enfrentamos en la actualidad y 10 que pod antiguo poema epico hindu, el Mahabharata? De ser mos esperar para el futuro, Houston nos dice con la elocue .1 asi, iestamos cometiendo los mismos errores? cia que se ha convertido en la caractedstica de su ohra: ,,' • Con al menos 20 guerras civiles, religiosas y poJ(ti- unieo esperado es 10 inesperado. Todo 10 que era, ya no es' cas en marcha hoy en dia, la "paz" que siguio a la todo 10 que no es esta empezando a ser. Nuestra era es una Guerra Fda ha sido solo una paz relativa. La tension de cambios cuanticos, probablememe es la era que mas ha d global y los arsenales cada vez mas grandes de armas truido y reconstruido en la historia del mundo. Y nosot de efectos masivos hacen que un conflicto planeta- somos quienes debemos seguir adelante" Y rio de resultados catastroficos sea mas probable aho- ra que en ningun momento en los ultimos cien afros. RESUMEN DEL CAPITULO 8 • Ejemplos de las tradiciones de los nativos america- nos y observaciones de la naturaleza muestran c1ara- • Con el fin del milenio todavia fresco en la memoria, mente que la unidad y la cooperacion ofrecen una los ciemificos se preguntan si sobreviviremos 0 no mejor posibilidad de sllpervivencia que la compe- otros cien afros desatando los poderes de la naturale- tencia y la agresion, La unidad y la cooperacion se 250 El C6digo de Dias consideran ahora vencajas estrategicas, al·igual que verdades espirituales. £1 mensaje de nuestras celulas ofrece una razon para creer que tal unidad es po- sible. • Los futuristas vislumbran una epoca en nuestro fu- turo no muy distance en la que la enfermedad y eI 1I~~:~~1l0S con. cinco ded~';::: . sufrimiento actual sea cosa del pasado. La dave para Se nOs~~eL1'~ delpensamiento llegar a esa epoca es que nosotros, como civilizaci6n, ":y~~Vi'<tt~'nt.~tra5 manos. sobrevivamos 10 suficiente como para lograr la com- Y~O~~5 con citi,~d~OSI '" prensi6n cienclfica y espiritual que sedan necesarias . ! :,,_.q'IJlo~ .; '".f"-;',:; ~,)~-,'< ·is\Salcli!:. . ""'''.' - : ' . ',h, para hacerlo. ·NQAl?~·~M~~.pIN~~. , .'" '{. -. r ' ~,,';" ':, ~ '0. 'r~ . " '~ 1; Capttu[o Nueve EL CODIGO DE DIOS: Una razon para creer S ~, ' iempre me han fascinado las multitudes. Prevalece una sensaci6n, que con frecuencia se describe como "electrici- ,'dad". y que s610 se presenta cuando cientos 0 miles de perso- nas se reunen en eI mismo lugar y al mismo tiempo. En medio , del caos organizado de tantos individuos, eada uno inmerso >en los asuntos de su propia existencia, es facil imaginarse que tales experiencias juegan un papel menos axiomarico en un ,plan de mayores dimensiones. Aquellos que andan de com- ,pras 0 los que simplemente se trasladan de un lado a orro, van tan coneentrados en sus diligencias, en sus reuniones, 0 en la persona que camina a su lado, que por 10 general no se perca- , tan de la realidad de los que los rodean, aunque algunas veces ; los separa s610' una minima distancia. Sin embargo, en toda , muchedumbre, desde los conciertos y los restaurantes, hasta ,las salas de sesiones y los patios de reereo, cada una de las per- r sonas es el producto de todo el dolor y la rragedia personal, aSI 254 El C6digo de Dios EI C6digo de Dios 255 como del exico y el jubilo que los eondujo allugar en don- han dado los mayores extremos en cuanto a sequ{as, tormen- de comparten un breve momento en el tiempo. tas, inundaeiones e incendios, as! como los peores desastres AI deambular por los mercados exoticos del Peru, los baza- industriales y ambientales que hasta ahora se hayan registra- res del Cairo, los aeropuerros masivos que se han convertido do. I Desde los esrragos que ocasiono el Huracan Andres y las en comunidades independientes, 0 mientras nos sentamos en inundaciones de Europa Oriental, hasta las bombas de la ciu- un cafe al aire libre en casi cualquier ciudad, es cuando nos dad de Oklahoma y la explosion del reactor sovietico de Cher- viene a la mente una sola pregunra: "~Que se necesitaria para nobil, fueron codas tragedias que dejaron una marca indeleble reunir a toda esa gente en un momento de unidad comparti- en nuestra memoria pero que tambien proporcionaron algu- da?" De la misma manera que un himno nacionallleva a las nas de las mejores oportunidades de colaboracian. personas mas alIa de sus diferencias, su cultura, su religion y su , Sin duda alguna, durante el mismo lapso de tiempo, ram- estado social, ~que verdad podria revelarse que pudiera tener , bien hemos podido experimentar un sentimiento de solidari- un efeeto semejante? ~Que Frase podria enunciarse que tuviera , dad que se deriva de sucesos afortunados. Se dieron eventos el poder de trascender las creencias que tal vez hayan separado , placenteros entre personas que eran absoluros desconocidos, a muchas personas en el pasado y que pudiera ofrecer una ar- ,como las bodas de la realeza, los partidos finales del Super monia que perdurara, mucho despues de transcurrido el mo- , Bowl y las competencias Olfmpicas, las que nos han propor- mento? ; canada momentos de regocijo y una razan para disfrutar una experiencia compartida. Sin embargo, estos momentos han sido con frecuencia irrupciones efimeras de entusiasmo, mas que Experiencias que unen ',sucesos que modiflquen la vida y que puedan moldear de ma- En debates informales durante seminarios 0 conferencias, for- 'nera legltima el curso de la historia. Con mayor frecuencia, los mula precisamente esta pregunta a los partidpantes. La res- .' participantes consideran las tragedias como oportunidades mas puesta mas frecuente es una que se fundamenta en una propicias para lograr la unidad. experiencia personal y en una perspectiva historica. En cuanto Las imagenes del 11 de septiembre del 2001 permanece- a recuerdos recientes, cuando pensamos en personas que se ,ran vividas en la mente de esta generacion y con coda probabi- reunen, par 10 general descubrimos que es en respuesta a una Jidad, en 1a de muchas generaciones futuras. ~Quien puede necesidad de solidarizarse, como en alguna tragedia comparri- ,'olvidar 1a imagen de esas personas de coda condicion y de di- da a debido a una meta comun. versas nacionalidades, que de repente, en un solo dla se unie- Durante la segunda mitad del siglo XX, se tuvo la impre- , ron para escapar vacilantes de los edificios ardientes con el sion de que nuesrra familia universal padecio un numero exce- ,'cuerpo cubier~o par una capa de pavorosas cenizas grises? sivo de acontecimientos catasrroficos, algunos ocasionados por (Quien puede olvidar las emociones encontradas de horror y el hombre y orros por efectos naturales. Esta conjetura se con- de orgullo de los oficiales de la policia y de los bomberos, que firma de manera estadistica, ya que en los ultimos 100 afios se , entraban a los mismos edificios una y otra vez para salvaI' .1 256 El C6digo de Dias El C6digo de Dios 257 otros, s610 para desaparecer y esfumarse en el infierno subse- desde sus emranas. Dejando a un lado 1a 16gica que par norma cuente? general los apartar{a del peligro, fa experiencia les desperro De pronto, los banqueros, los prestadores de servicios, los alga mucho mas profunda y actuaron. chefs de restaurantes y los vendedores ambulantes, estaban tra- Los que han trabajado lado a lado en un esfuerzo desespe- bajando lado a lado can los equipos de rescate y can los tran- rado par salvar vidas, con frecuencia expresan que su fortaleza seuntes, para sacar al mayor numero de personas de entre los es alga mas que un simple espfriw de colaboracion con los escomhros de 10 que habia sido el orgullo del perfil urba- otros integrantes del rescate. Es como si surgiera una "fusion" no de la ciudad de Nueva York. En ese dia, en un contraste de almas que sabcn que juntas, son capaces de lograr alga mu- desolado con los horrores que resultaron de la peor expresi6n cho mas grande de 10 que un individuo pudicra obtener solo. de nuestra especie, tambien fuimos testigos de 10 mejor del En estas y en otras ocasiones semejantes, es el significado de fa genero humano. En ejemplos incontables de herolsmo de- tJivencia, mas que los sucesos en sf, 10 que cambia de manera sinteresado, individuos preocupados por los demas. arriesgaron permanente la vida de las personas. su vida, sin vacHar ni por un instante, para que otros pudieran Desde esta perspectiva, cuando me formula la pregunta VIVlf. : "~Que se necesitaria?" En realidad me estoy preguntando, "<que Ademas de 10 que dichos sucesos nos revelaron acerca de , vivencia podria compartirse por un gran numero de personas nosotros mismos como sociedad, tambitn nos ensefiaron alga : que pudiera despertarnos a todos a una mayor percepcion de acerca de nosotros como seres humanos. Aunque los inciden- solidaridad y determinacion? <Que se necesitaria para poder ir res son los catalizadores que nos agrupan en prototipos de "uni- , mas aHa del mero hecho .de captar nuestra atenci6n en un dad a traves de la tragedia," la fuena que despiertan en nuestro 'momento dado y que pudiera guiar nuestro corazon y nuestra interior, viene de algo mas aHa de los despojos de edificios , mente a una nueva realidad de colaboracion y paz que enaltez- humeantes. Durante las entrevistas que se tllvieron can los , ca la vida?" Y esa respuesta debe vincularse a 1a vivencia que se sobrevivientes de esos instantes, estos confesaron que el fuerte ::comprueba en el momenta del suceso. impulso de fortaleza que arras percibian como heroismo, pro- Cualquiera que sea el catalizador, cada uno de nosotros venia de un sentimiento surrealista y en ocasiones hasta "mis- , necesitarla compartir una vivencia que fuera tan profunda, tan tico" de una fuerza poderosa que los impeHa desde 10 profundo : personal y tan autentica que no pudiera ignorarse. Precisarfa de su ser. 'de un "sf" de aprobacion que saliera desde las entrafias y que Cuando en conferencias de prensa posteriores a la trage- ;; trascendiera nuestras rutinas cotidianas. Necesitaria penetrar dia, se les pregunto10 que pasaba por su mente en el momenta ',' hasta e1 mismo meollo de nuestra esencia, erizar el vello de en que actuaron, no era infrecuente que aquellos a los que se nuestro cuello y sacar Iagrimas de nuestros ojos, isolo porque les rendian honores por sus esfuenos sobrehumanos, respon- :sahemos que ;s algo fidedigno! Si una experiencia de dicha dieran que no les «qued6 otra alternariva". La experiencia di- i,magnitud pudiera sucederles a los que se encuentran en lIll recta de otro ser humano que estaba necesitado 1es hablaba . . aeropuerro, en un bazar 0 en un cafe en donde se planteara 1.1 ~- 258 El C6digo de Dios El C6digo de Dios 259 misma pregunta, entonees esa experiencia tambi~n serfa posi- de nuestras celulas dene la capacidad de eondueirnos, como ble para orres que no estuvieran tan eerca. una familia, mas aHa de las crisis amenazadoras de una teeno- Gracias a Ia experieneia personal de permitirnos comparrir logfa inconrrolable, de una guerra mundial y de la enferme- dicho momento, nos estariamos dando una gran oportuni- dad, hacia la cerreza de que valemos mas que el precio que dad: la oponunidad de percibir nuestro mundo y, tal vez 10 , hemos otorgado a la riqueza, allegado, a la tecnologia y a las que es aun mas importante, percibirnos uno a otro a la luz de fronteras. una posibilidad mayor. Es el sentimiento axiomatico de dicha Somos una familia -can roda probabilidad unica en su es- experiencia. direcra y profundamente personal, 10 que subsiste pecie dentro de la vasta extension de la ereaci6n. Como en mueho mas alIa del momenta. Debido a esra sensacion, en- . cualquier familia, la experiencia de uno de sus miembros indi- contramos una razon para creer que somas parte de alga mas ca la posibilidad de que a todos les pueda suceder 10 mismo en grande y (enemas la fuena para lograr que nuestro mundo sea otra oeasion. Cada miembro representa un potencial para la diferente. totalidad. Aunque esta posibilidad pueda pareeer muy remo- . ta, los extremos tragicos de una hambruna, de una enferme- dad, de una guerra. de la pobreza que sobreviene a alglin pueblo, II poder del momento ·sociedad 0 naei6n. en un momento dado, sieven de testimo- En el precisa insrante en que se da dicha experiencia de testi- ,j nio de que orros pueden padecer tragedias semejantes en algu- monio de vida que proviene del mensaje de nuestras relulas, ,na otra ocasion. toda hombre y cada mujer -cada abrero, empleada publico, , De la misma manera,.el exito de algun miembro de nues- padre, educadar; cada campesino y miembro de una tribu. ':tra familia tambien se convierte en un ejemplo de superaci6 n cada guerrero y cada sacerdore, sin importar ellegado, la raza ,y supervivencia para los demas. Cada vez que uno de nosotros o la religi6n- podrIa mantenerse ftrme en eI entendimiento de descubre la forma de superar la enfermedad, la imolerancia, la su relaci6n con un poder superior. Al adoptar esa mentalidad tecnologia de Ia negaci6n de la vida y el odio. la puerta se abre sin desconfiar ni titubear, podrian mirar a los ojas a aquellos ',para que orros puedan proseguir. que los rodean, con un nuevo sentimiento de conftanza, au- Aunque existen muchos remas en los que los Hderes mun- roestima y honorabilidad. 5i estan presentes aquellos a los que diales no concuerdan, prevalece una tendeneia sobre Ia que tal vez nunca comprendieron, ni toleraron y quiza induso les pareee haber poca comroversia: Los indieadores dominanres desagradaron en el pasado, esa experiencia les permirirfa ver de un cambio planetaria, demuestran que en la actualidad, fa algo que tal vez nunca habfan vista antes: la certeza concrera 'familia humana confronta los mayores retos de supervivencia de su minisrerio camun en un plan de mayores dimensiones. que se hayan registrado en la hisroria. Algunas de las mentes Tal vez sea menos significativo saber de forma precisa ha- mas brillantes'de nuestro tiempo estan de aeuerdo al al1rm:lr cia donde nos conduce dicho momenta, que nuestra disposi- que a no sec que cambiemos la forma de pensar qw: no... h.I cion de permitir que ocuna. EI mensaje que viene del interior rconducido a estas condiciones, estamos en la rraynlnll.l tic E 260 EI C6digo de Dias El C6digo de Dios 261 una colisi6n con la cacastrofe. Ademis de la amenaza de me- puntas de vista de la sociedad en general. Mas aHa de una diados de siglo respecto a un colapso de nuestros ecosistemas, simple respuesta al cuestionamiento referente a si estamos 0 la diseminaci6n de una diversidad de virus que son inmunes a no solos, Sagan sugiri6 que dicho descubrimiento podria ofre- cualquier terapia medicinal acreditada y los cambios de es- cer una pista respecto a la subsistencia de nuestra trayectoria quemas climatologicos que ya esran afectando nuestra capaci- tecnol6gica. dad para produeir cosechas vitales para nuestra manutencion, Con toda probabilidad, una transmisi6n desde la profun- ahora nos enfrentamos con la amenaza tangible de una guerra _didad del espacio vendria de una civilizacion mucho mas anti- global. gua y presuntamente mas evolucionada de la que ahora En presencia de tales problemas de gran escala -cada uno , tenemos. Las comunicaciones equivalentes a las transmisiones de los cuales amenaza eI futuro de nuestra especie- no es logi- por radio se desplazan a la velocidad de la luz y roman muchf- co el llegar a exterminarnos unos a otros por diferencias de simo tiempo para recorrer las enormes distancias entre los as- nuestros ancestros, por eI color de nuestra piel 0 por la forma tros y los planetas. Si suponemos que todavfa existen otras en que rendimos homenaje a Dios. Sin duda alguna «jtenemos -, civilizaciones, los ciendficos opinan que la distancia promedio cosas mas importantes que hacer!" entre elIas es de alrededor de 300 afios luz. Si pudieramos de- 'tectar una senal de una estrella cercana, esto significarfa que la , recibidamos 300 anos despues de que se envi6. EI Poder de un Mensa;e Si despues decidieramos responder a la senal, transcurri- Carl Sagan, antes de su muerte en 1996, especulo respecto al ; dan otros 300 anos antes de que se pudiera redbir nuestra impacto que podria tener sobre nuestras actitudes y sobre la : transmisi6n, ilo que haria un lapse total de tiempo de 600 sociedad, el descubrimienro de seres inte1igentes fuera del -afios para una sola comunicaci6n! Debido al numero impo- ambito de la Tierra. En su conocida disertaci6n SETI 2 , iden- ,'nente de estrellas en nuestra galaxia, 10 mas probable es que tifieD la busqueda de otras formas de vida como parte de una 'nuestro primer mensaje vendria de alguna parte mds distante curiosidad que es tan antigua como la humanidad misma. En "que la de nuestro vecino mas cercano. Esto significa que antes la primera Frase expres6: ''A traves de rada nuestra hisroria, ';de llegar a nuestro mundo, la senal habrla viajado una distan- hemos conremplado las estrellas y hemos reflexionado sobre la cia tan eoorme, jque cualquier conversaci6n significativa serfa posibilidad de que el genera humano no sea unico en su espe- -casi imposible! cie sino que ... existan otros seres que conremplen y se mara- : Sin embargo, desde la perspectiva de Sagan, el s610 hecho VI'11 en como nosotros -companeros - pensantes en e1 "3 cosmos-. -de recibir una senal de esta naturaleza nos manifestarfa qUl' la Mis adelante Sagan cement6 que aun cuando decidieramos civilizaci6n de origen habia sobrevivido a su evoluci6n [l'UIl I no contestar a una transmision extra-terrestre, la detecci6n ,,16gica. De sec'asi, ellos habrfan dominado las COnsCUIl'1H i.l" de la senal por si misma podrfa tener beneficios que afectaran de de haber adquirido una tecnologfa, sin destruirse a s! nmlllO" forma directa la direcci6n de la investigaci6n cientffica y los ': en el proceso. "Un solo mensaje del espacio", aEi nm') , .. dC1IIll" 262 El C6digo de Dios EI C6digo de Dios 263 tcaria que es posible sobrevivir a una adolescencia tecno16gi- Si definimos "contacto" como fa formulaci6n de un men- ca."4 Por afiadidura, Sagan indica que aunque no es rouy pro- saje viable, reconocible y proveniente de una Fuente que se bable, es bastante factible que "el futuro de fa civilizaci6n origina mas alIa de nuestro mundo, entonces el descubrimien- humana dependa de la recepci6n y decodificaci6n de mensa- to del antiguo nombre de Dios dentra del c6digo genetico jes interestelares". 5 humano, jbien podria considerarse como un contacto! Si el simple hecho de recibir una sefi<J. pudiera tener un impacto tan fuette sabre nuestra familia terraquea, imagina El tiempo perfecto 10 que podria significar si la seoal fuera reveladora, jun mensa- je que se pudiera interpretar! El conductor del programa, al lIegar a la segunda mitad de , nuestra enrrevista, anunci6: "jPermanezcan con nosotros! jRe- gresaremos despues del resumen de noticias que se da al termi- IContactol , no de la hora!" Escuche la interferencia ya conocida de la escatica Sin perder de vista la especulaci6n de Sagan, ~que sucederia si , de la transmisi6n del radio y el "sonido agudo" que indicaba utilizaramos los privilegios de recibir una sefial extraterrestre que estibamos fuera del aire unos instances durance la ince- con un mensaje de otro tipo? <Que pasaria si aplicaramos todo , rrupci6n. De pronco, la voz fuerte del moderador se escuch6 10 que conocemos acerca del significado de descubrir seres in- par el telefono: "iExcelente entrevista, Gregg, es un material teligentes en otros mundos, al mensaje que esti dentro de cada , irresistible! jEmpezamos can el pie derecho!" Durante los 30 celuia de nuestro cuerpo? En un sentido innegable, el nombre minutos previos, el tema de nuestra discusi6n fue la prueba de Dios en nuestras celulas viene de fueca de este mundo y al ciendfica de un campo conciente unificado que envuelve nues- mismo tiempo tiene un fundamento firme como algo de nues- , tco mundo y el poder que tiene ese campo como conducto tro mundo. Si en lugar de recibir el mensaje simb61ico de una para las oraciones de paz. Acababa de compartir los escudios sefial electr6nica desde 10 profundo del espacio, ~podrfa acaso I que confirman que cuando un ciecto numero de personas 10- el mensaje tangible del nombre de Dios desde el interior de , gra 10 que se denomina "emoci6n coherence" (como el que se nuestro cuerpo producir una experiencia anaIoga, con un efecto , erea a traves de sentimientos de paz unificados) se ha compro- semejante? ;bado que el efecro se extiende mas alIa del grupo que esd aran- Como denotan los estudios, la magnitud de una experien- do, hacia las familias y las comunidades en las que se Ilevaron cia que se comparte es 10 que enciende el mas alto sentimiento a cabo los estudios. de unidad entre personas de diferentes antecedentes. La certe- Aunque la reacci6n del conductor a estos estudios no flle za de la presencia de Dios que sederiva de una busqueda mul- i sorprendente, 1<;> que dijo enseguida me caus6 escalofdos. EIlI- tinacional y a traves de muchas decadas, como es el Proyecto ',pez6 por compactir su opini6n de que nosotros, COIlIO espl'l:ie del Genoma Humano, podrfa tener el potencial de producir I humana, somos el producro de una gran inteligencia antigua. precisamente dicho efecto. ,"Si esto es verdad," razon6 en voz alta, "entonees ell algunOl L 264 EI C6digo de Dios EI C6digo de Dios 265 parte de nuestro pasado esa inteligencia debi6 habet dejado La que el entrevistador no podia saber era que yo habra evidencia de su existencia. En algun lugar de este mundo debe llegado a un punto en mi invesrigacion que era basrante frus- haber una senal que es inconfundible -'la tarjera de presenta- trante. Aunque no habia cuestionado la existenda del c6digo cion' de nuestro Creador- para recordarnos que somos parte en si, habfa empezado a dudar sobre mi enfoque para encon- de algo mas grande que nosotros mismos". Apenas dandose trarlo. AI escuchar las palabras "jsolo espero que la encontre- un poco de tiempo para respirar entre frases, continuo: "Creo mos pronto!" senti que era predsamente 10 que necesitaba para que algun dia encontraremos esa prueba y se convertini en una animarme en ese momenta de mi vida. Para mr. el tono y el razon para dejar de luchar unos con otros. iSolo espero que la apremio de su voz resono como una suplica y sus comentarios encontremos pronto! (Tu que piensas, Gregg? ~Crees que es- me inspiraron, unos meses despues para seguir adelante y es- d. en alguna parte?" cribir este libro. jSUS palabras me tomaron totalmente desprevenido! El Opino que, en un nivel inconsciente y silencioso, cada uno hombre al otro lado de )a lfnea telef6nica no tenia forma de de nosotros trabajamos juntos de esta manera. Por el simple saber que durante 11 anos iYo habia estado a la busqueda , hecho de sec honestos en nuestras conversaciones, con frecuen- de exactamente esa prueba! Mi mente daba vueltas mienrras : cia decimos con precision las palabras correctas, en el momento discurrfa la forma en que iba a contestar su pregunta con ho- adecuado y los orros nos pueden escuchar en formas que nun- nestidad sin traicionar mi decisi6n de no discutir mis des- ca nos hubieramos imaginado. Esa noche, escuche como "no- cuhrimienros sino hasta haber concluido el trabajo y poder sotros" nos pedfamos que encontraramos la clase de prueba comparrirlo con responsabilidad. Sin embargo, en cuesti6n de que el director del programa habfa descrito y que nos daba segundos despues de formular la pregunra, al escuchar una vez ; una razon para creer que era posible tener paz en nuestro mun- mas la voz del conductor del programa, mi dilema se esfumo. ; do. El hecho de que se formulara la pregunta tambien sugiere "En diez segundos estaremos de nuevo al aire", dijo, y comen- que ahora es el tiempo perfecto para compactir el mensaje que zo el siguiente segmento del programa. Nunca tuve la OPOftU- hay en nuestras dlulas. nidad de contestar a la pregunta y nunca se volvio a formular. Las estadisticas que transmiti en el Capitulo 1 sobre perdi- No obstante, el hecho de que se huhiera formulado, es la clave " das de vida. represeman un testamento lobrego de la asevera- de este relato. cion de Eric Hobsbawm que indic6 que el siglo XX era "el Si en realidad estamos rodos vinculados a traves de un es- ..• siglo mas sanguinario" en el registro de la historia humana. Es tado conciente comparrido, es probable que existan muy po- en especial sorprendente advertir que las estadisticas esclare- cos secretos en nuestro mundo y con roda certeza menos cen 10 que muchas personas ya sospechaban; como especie, "accidenres". Desde esta perspectiva, aunque el entrevisrador debido a actos intencionales de violenda y al descuido del habIa hecho la pregunta a nivel personal, era como si, de for- bienesrar de l~s demas, nosotros somos los unicos responsa- ma conjunra, nuestra concienda colectiva hubiera formulado hIes de la perdida de muchos de nuestros semejanres, mayor la pregunta para todos; es decir, iesdbamos pidiendo ayuda! :, aun que la que se origina por los efectos de desasrres naturale.. 266 EI C6digo de Dios El C6digo de Dios 267 y por las enfermedades. Al enfrentar estos recordatorios funes- rna inrensidad, como 5i cada dfa que empezaba trajera una tOS de nuestro pasado, con frecuenda se me pide corrtpartir mi I nueva crisis. Desde entonees, la fuerza implacable de esa co- opinion sobre Ia posibilidad de que un poco de informacion bertura de alta tecnolog1a. trajo consigo una secuela que tal pueda lograr un cambio que consoIide la vida y contribuya a i vez no se esperaba. revertir la tendencia a la crueldad que ha dominado nuestro En diversos gradas, el publico en general, se ha insensibili- mundo desde hace por 10 menos cuatro siglos. ~Es posible que zado ante los reportes impresionantes de guerra y de terror. As1 pueda darse tal cambio en una proporcion significativa? iMi como los norteamericanos se tornaron insensibles ante las es- respuesta es un sf categoricot Ademis de ser posible, opino que tadisticas de las v.fctimas de la guerra durante los acontecimien- esta magnitud de cambio se puede lograr y es necesaria. £1 tOS de Vietnam, algunos sucesos notidosos que deblan haber mensaje de un Dios Eterno denteo de nuestras celulas ibien exigido nuestra cabal atencion antes de la rragedia del 11 de puede ser el catalizador que inicie dicho cambio! septiembre, se volvieron tambien rutina en nuestra vida. Tal vez sea precisamente porque todavfa esra por verse dicho La naturaleza y el esrilo de presentaeion que se requiere nive! de cambia a gran escala, que ahora sea la oportunidad en nuestros dias para absorber nuestra atencion durante algo perfecta. 5i vivieramos en un tiempo en el que Ia informacion mas que unos instantes, ha excedido todo aqueHo a 10 que que sacude los cimientos de nuestras creencias esenciales se escabamos acostumbrados en el pasado. Hasta las insinuacio- revelara de forma rutinaria, eI mensaje se podrfa perder como nes de la eficacia del sexo y del tabu requieren hoy en dfa un sucedio can el grito de "viene e1 "lobo' en la fabula. La conver- , mayor grade de impaeto, para sobresalir en la programacion gencia de tamas situaciones actuales que de forma individual " cotidiana. Es denrro de este contexto que se presenra la representan una amenaza para nuestro futuro, hace que este " oporrunidad de 'un cambio significativo, a traves del pader de sea el momento perfecto para descubrir que nuestra "unifor- . un mensaje que mueva a rodos los miembros de nuestra fami- midad" es mayor que nuestras diferencias. lia global. Un coroJario importante de los acontecimientos de! 11 de Puesro que el950/0 de nuesrra familia global cree en la exis- septiembre. fue la constante intensidad con que los medios tencia de un poder superior, el hecho de saber con tanta certe- de comunicacion informaron las consecuencias desastrosas de ; za que Ilevamos dentro un mensaje de esa supremada, ibien la tragedia. A pocas horas de los primeros reportes, se nos ane- podrfa rivalizar con la transmision mas importante que pudi~­ go con un nuevo formato de periodismo: los repones televisi- ra reeibirse hoy en dia de los medios de comunicaci6n! Sin vas que se reforzaban can ilustraciones grafkas impresionantes embargo, el tener conodmienro del mensaje que esra dCllu"O y los temas musicales compuestos can sumo cuidado que acre- de nuestras celulas, no garantiza que se de un cambio fllmb centaban eI drama, ya de par s1 reealcado, que se presentaba mental en la forma en que nos percibimos a nosorros n I i,\llll}\. ante nuestros ojos. Durante los dfas y los meses que siguieron, 5implemente' prepara el escenario al proporcionar 1111.1 1.11(')11 mientras buscabamos volver a la "normalidad" en nuestra vida , profunda y la opoftunidad para hacer algo al r('spt'< Ill, h till cotidiana, continmibamos recibiendo las notieias can la mis- punm de arranque. 268 El Codigo de Dios EI C6digo de Dios 269 Una especie que cambia exploraci6n, la conquista y la esdavizaci6n de concinenres y poblaciones enteras; 10 que equivale a traumas de proporcio- El cambia parece ser una parte fundamental de la naturaleza nes inimaginables. Junto con la historia de la expansi6n y la humana. La breve historia de nuestra especie esca llena de cam- i dominaci6n, tambiin hemos sido testigos de fusiones cultura- bios en diversos grados. Aunque algunos solo han neeesitado les, religiosas y raciales, 10 que es un ejemplo de nuestra habi- una ligera adaptacion a nuevas actirudes, otros han requeri- lidad para responder al cambio. Somos una especie de do un pensamiento ripido e innovador solo para sobrevivir. sobrevivienres, capaces de adaptamos a condiciones inespera- Por ejemplo, haee aproximadamente 10,0000 12,000 afios, das. A partir de este tipo de historias, es obvio que el cambio es nuest:~s antepasados experimentaron un grade de cambio que una parte importante de 10 que somos. Ojala tambien estemos e: easll~pensableen el mundo modemo. La evidencia geolo- dispuestos a hacer 10 que sea necesario para garantizar nuestro gica suglere que cerca del final de la epoca Pleistocena, 'oeu- ~ Illversi6n rn'0 una extrana . magnetica! En unas cuantas horasI y futuro colectivo. No obstante, todavia nos preguntamos que evidencia exis- dias, los habitantes de la Tierra en esa epoca fueron testigos de te de que una poderosa experiencia de unidad, y el cambio que un cambio de 180 grados, cuando el Polo Norte magnetico ~. implica, pudiera aceptarse a gran escala. En respuesta, me baso de la Tierra se convirti6 en el Polo Sur, y el Polo Sur se convir- . en 10 que creo es la dave para hacer cambios significativos que ti6 en el Polo Norte. . apoyen la vida en un mundo que en ocasiones parece estar al S610 podemos imaginar 10 que este fen6meno significo para .. borde de la autodestrucci6n. La dave es la propia naturaleza personas que no tenlan una cienda apropiada ni medios de . humana. comunicaci6n para explicarlo. Existen evidencias, como datos precedentes de arboles y f6siles, que indican que tambien ocu- rrieron cambios climaticos de gran magnitud. A juzgar por los {Una especle en la que hay "bondad" restos de mamuts prehist6ricos, congelados instantaneamenre ; AI principio, el tir6n casi no se notaha. Me habia yo aeostum- con el ultimo bocado todavia en fa boca, el cambio de clima y brado a los empujones, choques y encuentros cercanos que el p.rofundo congelamiento que 10 acompafi6, ocurrieron muy . son parte de una travesia con otras personas en lugares sin dptdo. De pronto, porciones de la Tierra que antes habian : mucho espado. En la primavera de 1998, tuve el honor de tenido un dima benigno y fertil sufrieron sequias, mienrras : organizar una peregrinaci6n de 23 dfas alas monrafias del cen- que zonas que siempre habian sido aridas y desiertas se enfria- .: tro del Tibet, un viaje que nos llevada a una altura de 17,000 ron y se llenaron de humedad. Nuestros antepasados ruvieron pies sobre el nivel del mar. Para aeostumbrar a nuestros ClIt:r- que adaptarse dpidamente para sobrevivir, yal parecer 10 10- . pos a tales extremos, teniamos programada una estancia tit- 4H graron. horas en Nepai. que tiene una altitud de aproximadalllt'lllt' Ademas de los efecros catastr6ficos de los fen6menos natu- 1,300 metros. Aunque las cifras de fa humedad y la It'lllpn.& rales, durante los ultimos 500 mos hemos experimentado la tura rivalizaban entre si, llegando casi a 90, esta hr{'\'(' \'1\11.' 270 El C6digo de Dios El COdigo de Dios 271 nos permitiria un aseenso gradual a Ia altiplanicie tibetana, y estaba viendo. Las personas a mi alrededor paredan ignorar nos dada tiempo para imbuirnos en la cultura nepalesa. Esta- por completo 10 que estaba pasando en el suelo bajo sus ojos. bamos de pie con nuestro grupo en el espacio abierto de Ia Era como si 10 que estaba ocurriendo fuera s610 para ese hom- hist6rica Plaza Bharkir de Kaatmandu, y se nos dificultaba bre y para mt. Habiendome acostumbrado a la enorme pobre- enrender el fuerte acento paquistani de nuestro gUla en medio za que habiamos visto en 165 ultimos dias, supuse de inmediato de las voces de los vendedores que nos invitaban a sus puestos. que este hombre era un mendigo yesperaba recibir una limos- Yo podria haber ignorado los tironcitos en mis pantalones na. Tome mi mochila y Ie di el dinero nepales que pude en- si no hubieran sido tan persistentes. De manera instintiva, mire contrar. Lo que sucedi6 despues fue una poderosa lecci6n en hacia abajo para ver eual era la causa de esta distracci6n. No cuamo a mi poder de discernimiento, mis expectativas y mis estaba preparado para ver 10 que vi. Mis ojos se encontraron SUPOSlClones. con la intensa mirada de un hombre que se vela muy anciano y Con una palma todavia en el sudo para equilibrarse, el cuyo rostro de escasa barba apenas si llegaba a la altura de mis hombre rechaz6 mi oferta. Moviendo la cabeza de izquierda a rodillas. El blanco brillante de sus ojos miraba a traves de lar- derecha para indicar "no", movi6 el dinero hacia mt con su gos mechones de cabello cano que no dejaban de moverse de- mano abierta. Con la misma mano, y con un solo movimiemo bido al dlido viento que barria las baldosas de la plaza. Casi me indico un edificio que estaba detds de nosotros. Levanre desnudo, y aunque la tradicionaI ceniza blanca que cubre a los , la vista y vi un templo muy anriguo de hermosura singular que hombres santos se aferraba a la humedad de su piel, se vefan se elevaba cerca de donde esdbamos. Por alguna raz6n, nues- manchas que revelaban el color oscuro de su cuerpo, que se tro grupo no se percat6 de el cuando entramos a la plaza. Ha- veia aun mas oscuro debido a afios de exponerse al sol de las biamos entrado frente aI musgo verde que cubrfa la fachada de zonas altas. ; intrincados diseiios que formaban el marco de las puertas y Me llev6 un momento encontrarle sentido a 10 que con- ventanas del edificio. Fijando la vista para ajustarla ala distan- templaban mis ojos. Mire por debajo de su cintura donde de- cia, empece a distinguir los fantasticos detalles que eran miles berfan estar sus piernas, pero 5610 estaban los dobleces de una y miles de diminutas figuras humanas esculpidas en la anti- tela sucia que llevaba como taparrabos y que llegaba hasta eI quisima madera, algunas de elias eran dioses hindues. suelo. En lugar de piernas, habfa un trow de madera con rue- AI volver a dirigir la mirada hacia abajo para darle las gra- das bajo su cuerpo, manchada y oscurecida por los afios de ;. das al hombre por mostrarme este lugar tan hermoso, el ya no uso. Este trow de madera era al parecer su unico medio de 10- estaba. Busque por el suelo, mis ojos escudrifiaron entre los comocian. cuerpos de los peregrinos y turistas que caminaban en la plaza. Me aleje de el instintivamel1£e, algo sorprendido por la ex- De pronto, vi la espalda del hombre a medida que se akj;lh.1. periencia. Sin decir una palabra, el hombre puso lentamenre impulsando s~ tabla con ruedas, lenramente perc con flrnl(·,.l. las palmas de sus manos sobre el suelo y se acerc6 a mt Mire hacia la orilla de la plaza. Aunque pense en seguirIo pal.l .1.11 It- hacia arriba para ver si alguien mas habra norado 10 que yo las gracias, no 10 hice. Send que el ya habfa logrado III 'pl!" .. r 272 El C6digo de Dios EI C6digo de Dios 273 habia propuesto 0 de 10 eontrario no se habrfa alejado. He hombre me habia dado mucho mas en ese dia que su simple aprendido que este tipo de experieneias breves a menudo son accion de sefialar un edificio. leeciones poderosas, y estaba segura de que este momento ha- AI nivel mas fundamental, siemo que somas una especie bia sido una de eHas. en la que hay bondad, compasion y una actirud de atencion AI principio habia juzgado al hombre, poniendolo en la hacia otros; como 10 habia demostrado el hombre de la tabla. categoria de los mendigos que por 10 regular piden limosna y AI mismo tiempo, por necesidad, tambien somos una especie que se han vuelto tan comunes en todo el mundo. No s610 no de guerreros y sobreviviemes. Cuando se nos Ileva a los extre- queria una limosna; ese hombre rechazo el dinero que Ie ofre- mas, tenemos el poder, la capacidad y la volumad para superar d. En ese momento recibi la leccion: Aqui estaba un hombre nuestra naruraleza bisica yvolvernos violentos cuando se tram que muy probablemente no tenia clonde vivir ni una familia de proteger y de sobrevivir. Las circunstancias, ya sean reales 0 que 10 cuidara, y que obviamente no tenia piernas y poseia percibidas, que creemos nos amenazan como individuos, como muy poco ademas del taparrabos que llevaba atado ala cintura familias, comunidades 0 naciones, pueden provocar nuestra y la tabla bajo su cuerpo. A pesar de no tener nada, se habia violencia. En otras oeasiones, por mera desesperaci6n, ataca- acercado a mi no para pedirme algo. iSe me acerco para dar! mos circunstancias que parecen estar fuera de nuestro controL Mientras mi mente habia supuesto algo y pasaba a traves de . Sin importar cuaI sea la rawn por la que traicionamos 10 que todo tipo de torpezas debatiendo si era adecuado dade algo se ha considerado nuestra "bondad" fundamental, es en esos util a este mendigo, (nuestro gu{a nos habia dicho que no 10 momentos cuando somos testigos de los peores y mas aterra- hicieramos), el hombre de Ia tabla solo queria compactir una dores aspectos de nuestra naruraleza. parte de su mundo conmigo; y eso era todo 10 que queria. Como en todi generafizaci6n sobre las personas, siempre En ese momento, vislumbre un ejemplo de 10 que creo es existen excepciones. En cada sociedad, hay estadfsticas que la verdadera esencia de la naturaleza humana. En nuestro esta- .parecen refutar nuestra bondad, pues hay individuos que se do mas basico, libres de los esrorbos que nos hacen creer incIinan hacia las earacteristicas mas oscuras que rechazamos y que somos necesitados, que se esta abusando de nosotros, 0 que aborreeemos. AI vivir las peores pesadillas como la realidad de estamos en una lueha por la supervivencia, somos fundamen- su vida, casi todas las generaciones han experimentado el terror talmente una especie bondadosa y generosa; una especie en fa que podrfa describirse como <tel mal encarnado"; genre como que hay bondad. Mas tarde ese dfa pense en ese hombre y me Jack el destripador 0 Ted Bundy, que causan estragos en co- di cuenta de que 10 extrafiaba. Extrafiaba su barba, el olor a munidades y vecindarios que en otras aspectos respetan la vida. eeniza de su euerpo y fa mirada de sus ojos. Empece a eon5ide- En raras oeasiones, tales individuos han llegado a pucs- rar 10 diferente que seria mi mundo 5i nunea nos hubieramos [OS de enorme poder. Usando su carisma para seducir ejen:iros encontrado, y me senti bien al saber que existfa un hombre as! enteros de mod~ que Heven a cabo sus complots, cometen at ro- "all a fuera" en alguna parte. Gracias a 10 que sucedi6 despues cidades contra otras razas, otras naciones e incluso contra Sli de esos sentimientos tan poderosos, me di cuenta de que este propio pueblo. Hayen dia, ese terror ha asumido una IlUCV.) 274 El C6digo de Dios EI C6dlgo de Dios 275 dimensi6n, evolucionando a partir de individuos y de grupos Egipto. del Tibet y de America del Sur. hasta los vendedores de escasos recursos y convirtiendose en organizaciones inter- callejeros en los bazares de Luxor; al igual que a 10 largo de nacionales bien financiadas. Esos momentos de tinieblas para , Europa y las poblaciones rurales de Australia y America del nuestra especie, sin embargo, podrian ilustrar mas 10 que hace- Norte, la gente parece ser basicamente "buena" par naturale- mos en circunstancias extremas, que 10 que somas por naturaleza. za. Como individuos y como familias, encontramos formas de Por fortuna, los "Adolf Hiders", los "Slodaban Milosevics" y ser felices en cualquier circunstancia que nos enconrremos. Des- las organizaciones terroristas son la excepd6n y no la regIa, de los mendigos sin hogar y la gente que trabaja la tierra, hasta son pocos y se presentan esporadicamenre. las mentes privilegiadas en posiciones de poder tecnol6gico y Un credente corpus de evidencias antiguas, eruditas y cien- ~' politico, todos en general parecen estar buscando 10 mismo en tfficas muestran que si no existen condiciones que nos impul- ;', su vida: paz. alimento, resguardo, salud y la oportunidad de sen a actuar como animales, y si se nos da la oportunidad, , darle una buena vida a sus familias, y una mejor comprensi6n preferimos vivir en paz siendo considerados unos con otros y " de su lugar en la creaci6n. honrando los aspectos bondadosos de nuestra especie. 0, Abraham Maslow, uno de los grandes psic610gos del siglo : XX, se distingui6 en primer lugar por su trabajo en el campo del comportamiento social de los primates. En sus tiltimos N uestra verdadera naturaIeza : aDos. sin embargo, se dedic6 exclusivamente al eSludio de la El erudito del siglo XIII, Santo Tomas de Aquino, expres6 do- ; naturaleza humana, y observ6 "posibilidades maravillosas y cuentemente el sentido de nuestra benevolencia: "La bondad , abismos inescrutables" en nuestra existenda. Incluso teniendo de la especie trasciende a fa bondad del individuo, como la " colegas como Sigmund Freud, que proponfan a la lujuria, el forma trasciende a la materia". 6 Cuatrocientos alios despwSs, egofsmo, y la agresi6n como los rasgos de nuestra naturaleza el fi16sofo, estadista y naruralista. Francis Bacon expreso un , basica. los esrudios de Maslow 10 llevaron a creer que "Ia genre sentimiento similar cuando escribi6: "La inclinaci6n ala bon- ~' es decente en el fonda". 8 Su fe inquebrantable en nuestra bon- dad esra. impresa profundamente en la naturaleza del hom- dad permaneci6 finne hasta los tiltimos d{as de su vida, cuando bre... "7 Nuestro cardcter unico como especie, y nuestro cardeter escribi6 que la humanidad "tiene una naturaleza superior" como fundamental de bondad, es to que abre fa puerta al mensaje de parte de su esencia, y que nuestra especie puede ser "maravillosa nuestras etlulas para sembrar un cambio realy duradero en nues- a partir de su propia naturaleza humana y bioI6gica".9 tra vida. , Mas alia de las ilusiones. nuestra "bondad" fundamental se En rni experiencia al viajar a cada continente de la Tierra, " haee evidente en innumerables ejemplos que demuestran el exeepto la And.rtida. existe un cerna comtin que he encontra- poder de esta cualidad en nuestra vida. Mas que simplemente do entre las personas can quienes he tenido eI privilegio de : un fen6meno modemo, desde el herolsmo en las batallas dl' compartir el tiempo. los alimentos, la naturaleza y la vida dia- , los Cruzados Crisdanos hasta las recientes tragedias de illllll ria. Desde las remotas aldeas y monasterios en las montafias de , daciones, huracanes y terrorismo, eS comtin ver que 1II1 'I"I 276 El C6digo de Dios EJ C6digo de Dios 277 humana cia su vida par otro. Ante circunsrancias que amena- Americana; y de perras, gatos e incluso hamsters que alguicll zan a uno de nuestros semejanres, muy a menudo un insrinro rescata de una casa en llamas, arriesgando su peopia vida. basico de preservar la vida se vuelve mas fuerte que los miedos Despues del 11 de sepriembre, se organizo un proyecto al y preocupaciones que (enemos acerca de nosotros mismos, y que no se dio mucha publicidad. La gente iba de casa en casa actuarnos. Este instineo parece estar tan profundamente arrai- en los edificios de apartamenros y hoteles que se esraban de- gada en nuestra naturaleza que 10 extendemos mas alIa de nues- rrumbando y en casas que se habian incendiado en el Bajo (ra especie y hacia eI reino animal. Manhattan buscando animales domesticos que hubieran En agosto de 2002, ciertas regiones de Europa experimen- quedado abandonados en medio del caos. Los reporteros que taron las Iluvias mas fuertes y las peores inundaciones del si- cubrieron la norieia se enterneeieron hasta las Ia.grimas ante la glo. Yo esraba dirigiendo un viaje en eI sur de Peru cuando sarisfaccion de quienes arriesgaron su vida en edificios ines- lluvias torrenciales devastaban sitios hisr6ricos en Austria, Ale- tables y en el humo roxieo. Uno poc uno, los animales domes- mania y la Republica Checa. Durante la semana, vislumbre el ( ticos fueron rescatados, hambrientos, deshidratados y vivos; caos de la devastaci6n que llegaba via satelite a los aparatos de moviendo la cola 0 gimiendo suavemente en respuesta al television que solo captaban una estaeion en los hoteles cura- contacto humano. Una vez mas, en las horas y dlas que si- les de las montailas. De todas las imagenes que contemple en guieron alII de septiembre, aceptar la perdida de vidas ani- ese tiempo, las mas poderosas desde mi punta de vista fueron males como consecuencia de una carastfofe de tal magnitud, las de las autoridades que trataron de salvar a una elefanta cau- habrla sido aceptable y ciertamente justificado ante la enocmi- tiva de ahogarse en su jaula en la ciudad de Praga. dad de la rragedia. EI hecho es que, como especie, no 10 hici- Arriesgando su propia vida, cuando montafias de agua y mos. Algo en nuestra naturaleza fundamental considero desperdieios calan sobre elIos, los ofieiales trabajaron intensa- aceptable arriesgar la vida humana en un esfuerzo por salvar la mente para liberar a esra elefanta de la India de 35 ailos, Ha- vida animal. mada Kadir, mientras eHa era presa del panieo y se agitaba violenramenre en el agua. Al final, sus esfuerzos fallaron, y en Bloques de construcci6n para e[ cambio un momento de desesperaeion, los ofieiales deeidieron tomar la vida de Kadir rapidamente en lugar de dejarla morir aho- La naturaleza nos muestra que para pasar de un nivel de orden gada. 10 a otro se requiere un periodo de caos entee ellos. A partir del Habrfa sido mas faeil, y ciertamente aceptable, que en pre- colapso de una pauta existente y del caos resultanre, se riene sencia de tal caos, los trabajadores dedicaran su energia a sal- una nueva pauta y un orden mayor. Tomando prestada la me- varse, a proteger sus hogares y sus familias. Pero al enfrentarse tMora popular de "ta calma antes de la toementa", este periodo a esa opci6n, algo en su interior rrascendi6 toda 16gica y actua- de caos podria "verse como "la tormenta antes de la calma". Ya ron a favor de Kadir. En ailos recientes, se han transmitido sea que estemos hablando del caos del divorcio que precede a rdatos similares sobre caballos en las zonas inundadas del Oesre la felieidad de un nuevo matrimonio, 0 del despido de un em-' 278 EI C6digo de Dios . EI C6digo de Dios 279 pleo que lleva a toda una nueva carrera profesional, cada bene- En este marco de referencia, dos de los factores necesarios ficio va precedido de un periodo de cambio inestable. Este para que un dato marque una diferencia significativa en nues- principia se ilustra daramente en 10 que parece ser una de las tro mundo, ya estan presentes: form as mas mfsticas pero eficaces de cambie entre algunos pueblos nativos: el sanar al cuerpo y a la mente mediante el · 1. La historia muestra que nuestra disposici6n a cambiar es uso de sonidos. inherente a nuestra naturaleza. La idea es que la "vida" tiene un plano inherente de salud, ·2. Las crecientes amenazas a nuestra existencia, hacen que el que siempre esd. presente, incluso cuando pareee que e1 caDs, prospecto de un cambio valga la pena. en forma de enfermedad, ha reemplazado al orden. Con un usa preciso de dnticos, tambores, sonajas, campanas, gongs, tonos y cantos, los sutiles patrones de vida del individuo que EI orro elemento necesario es tambien el mas obvio. Antes se esra. "sananda" se trastornan y se introducen en un caDs. , de hacer el cambia en nuestra vida, ya sea como individuos 0 Cuando el sonide se detiene, los patrones saludables se en- , Como sociedades, necesitamos una raz6n para creer que el cam- cuentran y se restablecen, pues la salud es el plano basico de la ~bio que estamos a punto de hacer puede lograrse. jNecesita- vida. Como la enfermedad no tiene un plano basko, no puede ,mos una sefial de que es posible Hevado a cabo! "encontrarse" y restablecerse. Simplemente desaparece y el re- sultado es que la persona "sana". 'La finna de Dios: una raz6n para creer De manera muy similar, en el mundo mas amplio de los pa- trones, las creencias, los prejuicios, los juicios y la intolerancia ;En meses recientes, revistas cientifieas y de otros tipos han que amenazan nuestra existencia son una "enfermedad" que descrito 10 que en la actualidad se considera una epidemia en no tiene un plano bisko. Para que ocurra un cambio duradero Estados Unidos: la obesidad. Las estadisticas muestran que la que apoye la vida, nuestro sistema actual de creencias debe 'mitad de la poblaci6n norteamericana tiene sobrepeso clfni- experimentar el desorden del caos para restablecer 10 que es ,co. II Faetores en el estilo de vida, como la dieta, el ejercicio, el verdad en nuestras vidas. Desde esta perspectiva, el cambia alcohol, y el habito de fumar, se consideran los principales es una forma de caos que daramente es parte de nuestra natu- factores que contribuyen a esta plaga que se extiende por toda raIeza. Para sanar las creencias que nos han hecho pensar que ;'la naci6n, aunque rodos elIas son habitos que pueden cam- nuestras diferencias son imolerables, se necesitan tres elementos: · biarse con relativa facilidad. La mayoria de los norreamerica· ,nos no se sorprende al ver los resultados de este tipo de esrud il ... ·Yeste tipo de noticias: jYa saben que tienen sobrepeso y nul n 1. Debemos estar dispuestos a cambiar. ·su causa! 2. Debemos creer que vale la pena haeer el cambio. Induso teniendo conocimientos mlly daros, Illih h.l .. pn 3. Debemos creer que el cambia es posible. I sonas no estan dispuestas a hacer los camhios q lie plld. 1.111 i t m ..... 280 El C6digo de Dios . EJ C6digo de Dios 281 tribuir a su longevidad, a su calidad de vida y a tener relacio- adoleseencia tecnologica. iLa dave de nuestra supervivencia es fies mas saludables. Lo tci5te es que s610 despues de experi- que debemos reconocer los principios fundamentales de nues- mentar una crisis personal de salud, que a menudo se re1aciona rra relacion con la vida, con nuestros semejantes yean el cos- direcramente con su estilo de vida, descubren la razon para mos, antes de pader aplicar 10 que hemos aprendidol creer que el cambia es necesario. Por eI ceta de su propia expe- Es cierro que en una escala muy diferente a 1a de los descu- riencia, descubren una raz6n para creer. brimientos de Copernico y van Leeuwenhoek, pero en una EI ejemplo de una obesidad nacional ilustra una de las ma- !fnea muy similar, parece que ha llegado el momenro de in- neras en que al pareeer aprendemos. iMuy a menudo, debe- fundir nueva sabiduria en nuesrra era de cambio, Aunque la mas experimentar to que no queremos en nuestra vida, antes de gran mayorla de la hum anidad cree en la existencia de un po- saber que no 10 queremos! En lugar de e1egir como preferimos der superior de eierta descripcion, para muchos, las realidades vivie (por ejernplo. opciones saludables de nutrici6n y de esri- del sufrimiento y la crueldad han creado dudas sabre la mane- 10 de vida), reaccionamos a 10 que la vida nos muestra, y roma- ra en que nos vinculamos can e1 Creador y con nuesrros seme- mas nuestras decisiones "despues del hechd'. james. EI reconocer que el nombre de Dios esca en el interior Parece que, como sociedad global, aprendemos de la mis- de las celulas de cada persona, del pasado, del presente y del rna manera. Tuvimos que experimentar los horrores del geno- futuro, ofrece una razon sin precedente para creer que vale la cidio y de la opresian global para condenar las po!fticas que los , pena un cambio. Lo que se necesita es precisamenre un carali- apoyan. Como nacian, Estados Unidos ruvo que experimen- . zador de esra magnitud para transformar la fuerza de nuestras tar la segregacian racial y de dases sociales, anreS de reconocer ; dudas en el poder 9-e la confianza. En la incerridumbre de un que las personas son mas que sus creencias y e1 color de su piel. mundo cambiante, esre ripo de evidencia sirve para renovar Histaricamente, las ideas nuevas que se basan salidamente en " nuestra fe en que hay algo "alIa fuera" en 10 que podemos creer, la verdad, han abierro la puerra a mundos de cambio y de y para ofrecernos una razon para confiar en nosotros mismos. posibilidades totalmente nuevos. Hasta que Copernico pre- senta evidencias de que la Tierra gira alrededor del Sol y no el Sol alrededor de la Tierra, no existia una razon para creer 10 Mas alla de nuestras diferencias contrario. Solo despues de que Antoni van Leeuwenhoek pudo Aunque nuesrras religiones, creencias y estilos de vida son par- ver las bacterias con las lupas que habra fabricado, se romo en te de la forma en que nos idendficamos exteriormenre, po~ serio el mundo de los microbios, que es invisible a los ojos. driamos estar en la entrada de la era en que superemos 1:1 Antes de verlos, no habia razan para creer que existian. necesidad de separarnos mediante diferencias, AI menos, d Como especie, hemos Ilegado al momento precario en nues- i. descubrimienro ,de que e1 nombre de Dios esra en e1 interior de tro camino evolutivo, en que estamos aprendiendo a tener ac- , nuestro cuerpo, tiene un mensaje que nos pod ria clevar a un ceso a la manera en que las fuerzas de la naturaleza se relacionan sentido mas alto de respeto y tolerancia haeia nuestro (adder con nuestra vida: la epoca que Carl Sagan identifico como , (mico como individuos. La naruraleza nos ensefla que nUt:S(f'.\ 282 El C6digo de Dios EI C6digo de Dios 2R3 diversidad, las diferencias que se han utilizado para justificar Pot 10 tanto; tal vez no es un accidente que eI nombre de accianes aparentemente sin sentido de miedo y de odio, es 10 Dios tenga las mismas letras y el mismo significado implicito, que afrece las mayores opoftunidades de supervivencia como incluso en idiomas que parecen apoyar las religiones y crecn- especie. De nuevo, volvamos la mirada hacia la naruraleza para cias mas diversas en el mundo actual. Aunque los eruditos re- que nos guie. conocen, por ejemplo, que tanto la tradici6n judia como la En un estudio sobre palomillas que se llev6 a cabo en la islamica tienen una ascendencia comun; a craves del patriarca decada de 1950, par ejemplo. se descubri6 que el colorido de Abraham, su interpretaci{m de las enseiianzas de Abraham han las alas den tro de la misma especie cambiaba segun el media variado mucho al paso de los siglos. [ncfllso atilt' fales difi'Tlw- ambiente, 10 que permitfa a las palomillas confundirse con el cias, el cdd{p'o numirim oeliito de 10.1 a!labf.'!{)J hebn'{) _)' {irt/bi' rt'- entorno. Las alas de las palomillas que vivian en los troncos de vela exacft/mente eI mi.rmo lJalor y rel da e.. . . a da!IJflJIf 1'1 1J1IJII/O J los arboles en la zona dande fueron Iiberadas para realizar el nombre secreto de Dios en eJ interior de nJif'Jlro (JIl'rpo. AI hacl..'t estudio, adoptaron una apariencia similar a la de la corteza de la, e1 codigo lleva el mismo mensaje de posibilidades y l..'Sfll' los arboles y eso dificultaba a las aves detectarlas al estar bus- ran:za a las tres religiones de mas de la mitad de la pohlaci('ll1 dl' cando alimento. De manera similar, las palomillas que se con- la Tierra: el Judaismo, el Islam yel Crisnanismo. centraron en un ambiente de rocas, adoptaron colores que Ies La Figura 9.1 ilustra como este poderoso vinculo crea Ull permitieron confundirse con su entorno. Pero las palomillas I puente entre estas tradiciones religiosas tan diversas. EI priml'r que no cambiaron e1 color de sus alas tuvieron una vida mas bloque ala izquierda muestra el c6digo de la vida a traves de carta, pues fueron presa bieil de las aves y otros insectos. La diversidad resultante de la capacidad de las palomiHas para adap- tarse, y la facilidad can la podian cambiar fue 10 que ayud6 a DNA DNA DNA • • 12 su supervlvenCla. como elementos como tetras hebreas como letras arabes , , De manera muy similar, nuestra capacidad para pensar en forma diferente y adaptarnos a las condiciones de nuestro mun- Qu/mica Hebreo Valor' 'kabe Valor do cambiante es 10 que garantizara nuestra supervivencia como " }'It Hidr6gen6 rod -10 10 especie. En una declaraci6n que ya es famosa, Einstein resu- Nitrogeno ',Hey 5 HA 5 mi6 este concepto: "Los problemas que enfrentamos hoy en Oxfgeno Vav' 6 WAW 6 dia no pueden resolverse al mismo nivel de pensamienro que , Carbona Gim,el, , 3 ,JYM 3 teniamos cuando los creamos." Si todos percibieramos el mun- Valor Combinado 6 6 do precisamente de la misma manera y ruvieramos las mismas soluciones para nuestros problemas, la primera vez que come- Figura 9.1: Comparad6n de los elementos de la vida y sus eL)Uivalenles en los alfabctos hcbrco y arabe. Aunquc extcrnamente los idiomas SOil tieramos un error podda ser la ultima vez que £uvieramos la difcrcntc;;, los cbdigos numcrico;; son los m.ismos, y producen d mislJll' oportunidad de cambiar. mcnsajc en ambos idiomas. 284 El C6digo de Dios El C6digo de Dics 285 los elementos del ADN: hidrogeno, nitr6geno y carbono. En Un [ugar para comenzar el bloque de en medio, se muestra el mismo c6digo con sus En afios recientes, eI estudio de la soluci6n de conflictos se ha letras equivalentes en e1 alfabeto hebreo: Yod, Hey, Vav y Gimel reconoddo como una ciencia especializada y en evoluci6n. Qui- (YHVG). El bloque de la derecha ilustra de nuevo el codigo, l,a la rama de este campo que crece con mas velocidad es la en esta ocasi6n en arabe. 13 En los bloques de en medio y de la Soluci6n Alternativa de Disputas [Alternative Dispute Reso- derecha, el valor de cada letra aparece a su derecha, en Ia colum- lution (ADR)], que esd. disefiada para crear soluciones nuevas na de "Valor". El resultado es obvio, las implicaciones enormes. e innovadoras para situaciones en las que las soluciones son El mensaje en e1 interior de nuestro ADN dice precisa- volatiles. Finalmente. tal vel, la mejor forma de expresar la meta mente 10 mismo tanto en arabe como en hebreo. de ADR es a traves de un anlculo sobre conflietos relaciona- Estas relaciones muestran gnificamente algo que ya sentimos a dos con el agua entre pueblos indigenas contempocaneos. En nivel intuitivo. Las letras del nombre de Dios en el interior de un artlculo publicado en la revista "International Negotiation", nuestro cuerpo son universales, a pesar de nuestras diferencias. Aaron T. Wolf, un profesor de la Universidad Estatal de Ore- Dentro de cada celula de cada cuerpo, encontramos el mismo gon, define ADR como un numero de enfoques "con los que codigo, con el mismo mensaje; y trascendiendoellenguaje, la las partes en conflicro buscan voluntariamente llegar a un acuer- fe y la raza del individuo, sin prejuicios ni excepeiones. do aceptable para ambos". 14 Aunque es posible que eI termino Aunque muchas personas han sospechado que un mensaje sea nuevo, Wolfsugiere que muchas tecnicas modernas tienen de este tipo debia encontrarse en algUn lugar, gracias al codigo en realidad rakes antiguas en las sodedades indigenas, y"al que esca en eI interior de nuestras celulas, esta sospecha se haee parecer los pueblos indigenas las han estado usando durante realidad. Como e1 codigo se basa en valores constantes, repeti- siglos, si no es que durante milenios".15 bles y verificables, el hecho de su existencia es claro. Mas alIa En una situacion similar a la que enfrentamos nosotros de las medforas 0 las ilusiones, la presencia del codigo, en Sl, hoy en dfa como sociedad global, las comunidades antiguas, no puede negarse. para sobrevivir a los retos de su existeneia, descubrieron que a Aunque el texto literal del mensaje: "Dios/Eterno en el in- nivel colectivo, les convenfa trabajar juntos para resolver los terior del cuerpo" sin duda quedad sujeto a diversas interpre- problemas que amenazaban su futuro. taciones, eI hecho de que eI mensaje existe es fiUy elocuente. Uno de los ejemplos mas daros de estes merodos tradicio- Sin importar «quien" 0 "que" creamos que es la fuente de nuestro nales en acci6n, puede verse en la practica conocida como ejer- codigo genetico, el enorme grado de orden que el mensaje im- cidos de vision compartida. Wolf describe estas tecnicas en Sll plica nos dice que hay algo "alIa fuera". Esto nos recuerda que investigadon sobre las disputas por agua entre los pueblos bc- somos parte de un panorama mas grande, y tal vel, de un plan reberes en la region del Valle M'goun de Marruecos. 1(, A rraves mas grande. Por estas razones, el mensaje de nuestro cuerpo es de su vision compartida, cada individuo offece un punto de algo sin precedente en su papd de proporcionar una platafor- vista sobre la forma en que eI conflicro podrfa verse si sc resol- ma, un terreno comun para la solucion de nuestras diferencias. L 286 El C6digo de Dios EI C6digo de Dios 287 viera con exi to, al igual que un pumo de vista sobre 10 que de partida desde el cual empezar y superar su desconfianza y podria pasar si las negociaciones fracasaran. El proposito de la empezar a sanar. Desde los musulmanes y los serbios de Koso- vision es proporcionar un foro que eomribuya a fundamentar vo, hasta los palestinos y judios de Israel, el recuerdo de arroci- 10 que quisieran lograr juntos. En esta forma, ambos lados son dades y violencia recientes han creado una sensacion de autores del resultado final y se sienten induidos en el proceso. I deseonfianza entre los oponentes que deja poco espacio para la Ademas, cuando los temperamentas se exaltan y la soluc.i6n paz. En situaciones como esta, ha sido dificil vislumbrar el parece poco probable, la vision compartida se convierte en un i final de un dia sin violencia, sin mencionar un fururo compar- punta de referencia at eual regresar, para reafirmar el punto de tido y pacifico, Pedirles a estas personas que creen la vision de vista com un que hizo que se reunieran en un principio. un futuro en comun, llega allfmite de nuestra sensibilidad, AI compartir sus esperanzas y suetlos sobre como serIa una Preeisamenre en tales circunstancias, el mensaje de nuestro soluci6n positiva, las partes en conflicto crean un puente entre cuerpo podria servir a un bien mucho mayor. Aunque vislum- el conflicta del momento y las posibilidades de un futuro me- brar un futuro compartido podrla ser dificil en medio de un jor. Ademas, su vision podria usarse para disipar e1 enojo que a eonflicto al parecer interminable, el reconocer una idenridad menudo surge euando las partes se encuentran cara a cara, y comun, sabiendo que cada individuo est<l. impregnado con la tambien como una razon para creer en el proeeso. Utilizando firma indeleble del mismo Dios, ofrece un hecho que no pue- las visiones, el hak'm (un juez regional que usa una combina- de negarse. En esta evidencia unica e inmutable se encuentra cion de costumbres y tradiciones que beneficien a ambas par- la verdad de una familia, un pasado comun, y un lugar para tes), "pone la disputa en el contexto mas grande de sus historias empezar. Con el ~onocimfenro de una presencia mayor en el y valores comparridos". 17 Con el usa exitoso de las visiones material mismo con que esta hecho nuestro euerpo, la vision comparridas aplidndolo a una variedad de problemas, es muy de un futuro compartido empieza a tener senrido. raro que las disputas de las tribus del Valle M'goun lleguen a En los primeros atlas de este nuevo siglo, muehos de los una autoridad mas alta. conflictos mas violenros, que han eobrado muchisimas vidas, se El tema de la vision compartida es muy simple y ademas han justifieado con interpretaciones extremas de textos religio- represenra la posibilidad de una experiencia comlin. Aunque sos. Con base en 10 que dicen frases especificas de las escriwras un futuro colectivo de paz mundial es la esperanza de muchas Cristianas, Judias 0 Musulmanas, se han destruido f..'1milias. sC' personas en la actualidad, al mismo tiempo somos testigos de han dejado huerfanos, y se han arruinado naciones. Ell ('\1(' ejemplos de odio que son tan fuertes y tienen una desconfian- tipo de conflicto, eI mensaje del interior de nuesHas ttlutu za tan profunda y heridas tan graves que vislumbrar un bien podria tener un poder aun mayor, y podria asumir Ull .. igruliu· eomun es como pedir algo imposible. , do mas profunda. La presencia del nombre de I )im ('11 marauo Asi como la genre pierde confianza en su euerpo cuando el cuerpo permanece como un recordatorio inddchlr- (Ir t1 ur ..... poder de la enfermedad pareee ser mayor que la posibilidad de sola presencia, una fuerza mas grande q lH.' llun If .1" It I(".n '4m- sanar, la genre que ha esrado en la guerra necesita un punto · I. b lantes d« e correcto e «,mcorrecro, ", ('x 1.'>1 t· n HIlO I.1 \-'U I .1 rll \1I ~, 288 El C6digo de Dios EI C6digo de Dios 289 Para los individuos y las naciones que pelean entre ellos amigo que cambiara el asiento con ella, y ahora esraban tra- por razones justificadas por sus religiones, cuyos principios se rando de pasar por encima de otros para instalarse en sus nue- basan en el Dios que vive dentro del cuerpo de sus "enemigos" vos asientos antes de que el avion se alejara de la puerta de at igual que en el suyo, las batallas empiezan a perder sentido, abordaje. Cuando todo se dijo y se hizo, me encontre junto a en esta forma, el mensaje de nuestras celulas dene induso una un oficial de la Fuerza Aerea que regresaba a una base militar mayor posibilidad de unidad para aqueHos que basan sus con- en Nuevo Mexico donde estaban su esposa y sus hijos. flicros en el nombre de Dios. Antes de que el avion lograra despegar, ya habfamos inicia- Es interesante que tanto en las comunidades Bereberes do la tipica eonversaci6n que se tiene en los aviones, imercam- como en las de Beduinos que describe Wolf en su articulo, la biando cortesfas y describiendo donde hablamos estado, a solucion del conflicto a menudo va seguida de una ceremonia donde {bamos y 10 que harfamos cuando llegaramos aIla. En conocida como sulha, que es un ritual publico de perdon se- cuamo se permitio el uso de aparatos eleetronicos, el hombre guido de una celebracion. El momenta del sulha marca un abrio su computadora laptop y se coneemro en Ia informacion punto culminante en la re1acion entre las partes que estaban que brillaba desde la pantalla de su LCD. Sintiendose relajado en conflicto solo unos dfas 0 semanas antes. En circunstancias despues de nuestra conversaei6n inicial, empez6 a deseribir su ideales, el ritual s610 se lleva a cabo cuando ambaspartes sienten trabajo y como habfa cambiado despues de los ataques al World que la situaci6n se ha resuelto. Can este ritual de perdon y Trade Cemer y al Pencagono el 11 de septiembre. AI hablar celebracion, se tiene un nuevo comienzo, se cierra toda una sobre las nuevas estrategias de seguridad naeional y como e1 experiencia y la vida se inicia de nuevo. terrorismo habia re-definido el papel de los militares, deseubrl A medida que las naciones se alejen de los conflictos que que mi fascinacion no se debfa ramo al tema en S1, sino ala amenazan el bienesrar de sus ciudadanos y nuestra comunidad pasion de este hombre par 10 que el erda, y el orgulIo con el global, 10 que parece faltar es el poder de una senal externa de .. que ahordaba sus responsabilidades. Empece a pensar en Ia perdon. La eficacia de este tipo de gesto de fuerza que lleve a ironIa del momenta. una conclusion duradera, no puede sobreestimarse. EI trabajo del oficial era entrar en eontacto con los recursos de las armas militares mas poderosas y con los mejores siste- mas de tecnologfa que se hayan registrado en Ia historia, y usar Nuestra unica verdad inmutable : esa fuerza para combatir contra aquellos que amenazan nues- Sentado junto a la ventana, levante la vista de los papeles que . tros hogares y nuestro estilo de vida. Por otra parte, desputs dd tenia en e1 regazo para ver de que se trataba la conmoci6n. Al : periodo en que trabaje en la industria del espacio aen:o dcs- escuchar trozos de conversacion, me parecio que la mujer que :, pues de la Guerra Fda, mi coneentracion habia esrado en lrCM estaba sentada junto a mi euando aborde el avion tenia un : un puente entre la sabidurfa del pasado y 10 que sab('mos en 1.& amigo con e1 que querfa sentarse en otIa seecion del avion. actualidad para ayudarnos a evitar la necesidad de ('sa gtu" f.I. Habra convencido al hombre que estaba sentado junto a Sll ! precisamente. Me preguntaba que posibilidadl's hahLi dc' qur 290 EI C6digo de Dios El C6dlgo de Dios 291 todo el movimiemo que se habla llevada a cabo para que que- desenvuelven los sucesos del mundo. 5610 existe el "nosotros". dicamas en asientos conriguos hubiera sido "casualidad". Juntos, nosotros estamos resolviendo nuestras diferencias y re- Despues de que el oficial describi6 sus nuevas responsabi- solviendo nuestros problemas en las unicas formas en que sa- lidades, nuestra conversaci6n cambi6. Era obvio que este hom- bemos como hacedo. Una parte de nosotros conHa en los bre era excelente en su trabaja. La que el aportaba a la milicia metodos comprobados de nuestro pasado: batallas, guerras y brotaba de un profesionalismo y determinacion personates, y antiguas ideas puestas en acci6n mediante tecnologia moder- del argullo que viene de saber que los esfuerzos que se hacen na, can el fin de resolver los problemas que surgen entre pue- contribuyen a un esfuerzo mayor. Le exprese mi aprecio por la blos y naciones. AI mismo tiempo, sin embargo, otra parte de forma en que abordaba su trabaja: "me cia gUStO que este listed , nosotros lucha por cambiar la manera de pensar que ha lleva- hacienda 10 que haee y que 10 haga tan bien porque yo nunea , do a la necesidad de tener armas y ejercicos que hagan posible poclda haeer Sil rrabajo". la guerra. Estamos viviendo en un periodo de la hisroria en eI "~En serio?", respondi6. "Es interesante. ~y que es 10 que ,que ambos puntas de vista deben coexistir, mientras que e1egi- usted haed" pregunc6. Despues de una breve descripci6n de , mos juntos el camino que seguiremos para entrar al futuro. mi busqueda de sabiduria para evitar la guerra, el se ri6 por La ironia de nuestra epoca historica es que ambas form as s610 un momento. Luego me devolvi6 el cumplido diciendo: de pensar tienen el apoyo de gente buena que trabaja para "Me da gusto que usted este haciendo 10 que hace, porque yo ,Iograr un mundo mejor en la unica forma que entienden. EI nunea podria hacer su trabajo. jEs una manera de pensar tan ,reconocer esro bien podria ser la clave para sobrevivir la transi- diferente!" "cion. Aunque las formas de ,actuar del pasado nos aportan un Comparrimos una carcajada ante la ironia de nuestras vi- :, tiempo precioso, la' cuesti6n es si tenemos 0 no la sabidurfa das y continuamos resolviendo los problemas del mundo du- ,para usar el tiempo con prudencia para cambiar la manera de rante el resto de nuestro viaje. Para cuando aterrizamos en pensar que cree que Ia guerra es la solucion de nuestras dife- Albuquerque esa noche, era obvio que queriamos 10 mismo para nuestras familias y para el mundo, y est:ibamos contribu- Mi conversaci6n con el oficial s610 fortaIeci6 mi creencia yendo a esa meta comun de maneraS muy distintas. AI dirigir- de que estamos trabajando juntos como familia global, quizas nos a la zona donde se recoge el equipaje, nos deseamos buena 'en formas que rodavia no hemos reconocido ni comprendido. suerre y nos despedimos. Mientras bajaba yo por la escalera Sin embargo, a medida que seguimos descubriendo 10 profun- electrica, empece a darme cuenta de que con esa breve conver- damenre que se extienden las rakes de nuestro "arbol fami- saci6n, eI oficial y yo habiamos experimentado un reflejo de la .liar", hay algo de 10 que podemos estar absolutamente seguros: forma en que parece funcionar la capacidad consciente a una Asi como la "sangre" une a los familiares mas lejanos mediamc escala mucho mayor. ,;d conocimienro'de su legado, el mensaje de nuestras celllla~ Suponiendo que nos une un campo unificado de conscien- os une en el conocimiento de que cada uno de nosocfOS Ileva cia, no puede haber un "elIos" y un "nosotros" a medida que se a misma historia y la firma del mismo Creador. Con esc mCll- 292 El C6digo de Dios EI C6digo de Dios 293 saje, estamos seguros de que, ademas de compartir nuestro pla- Mas alia de dasificaciones como Cristiano, Judio, Musul- neta, nuestro pasado y nuestro futuro, estamos intimamente man, Hindu, Budista, Shinto, Nativo, Aborigen, blanco, negro, inmersos en las elecciones de quienes nos rodean, la tinica fa- rajo 0 amarillo; hombre, mujer 0 nino, el mensaje nos recuerda milia que conocemos. que somos humanos. Como humanos, compartimos los mis- Una vez que conozcamos la verdad de nuestra familia hu- mos antepasados y existimos como hijos del mismo Creador. mana, no podemos "dejar de conocerla". Una vez que vemos En los momentos en que dudemos de esta inmutable verdad, la evidencia en blanco y negro, es imposible "dejar de verla" . A > 5610 necesitamos contemplar a las celulas de nuestro cuerpo parrir de ese momento, ya no podemos decir que la ignorancia , para recordar. es la razon por la cual justificamos el odio, el sufrimiento y las . Este es el poder del mensaje que esra en el interior de nues- atrocidades que han marcado al ultimo siglo, , tras celulas. Mis alla de toda duda razonable, cada uno de nosotros comparre el antiguo nombre de Dios en nuestro cuerpo, de la manera mas intima imaginable, Cada fibra de musculo, cada RESUMEN DEL CAPITULO 9 cristal de hueso, las lagrimas que derramamos, y los producros • La experiencia nos ha mostrado que la humanidad de desecho de la vida, todo es Dios. tiene una habilidad extraordinaria para unificarse en En esta comprension, simple pero poderosa, esra el hilo de momentos de necesidad comtin. Hist6ricamente, las nuestra unidad y la clave de nuestra supervivencia. Aunque no tragedias han proporcionado 1a mayor oportunidad sepamos can precision que reros enfrentaremos en nuestro fu- para poblaciones gr<\ndes y diversas para unimos en turo colectivo, una cosa es cierta: Sin importar cuales sean nues- torna a una'causa comtin. tras pruebas, las enfrentaremos como familia global. Lo que el • (Que se necesitaria para crear una experiencia uni- destino Ie depare a una comunidad, pueblo 0 naci6n, tambien versal de unidad, sin tragedia, que pudiera eliminar es posible para otros. Se requerira cada apice de nuestra sabi- nuestras diferencias y despertamos a un mayor sen- durla colectiva, de nuestra pasion para preservar la vida, y de la tido de prop6sito? fuerza que solo puede venir de nuestra diversidad, para que • En su importantisimo articulo sobre la Busqueda de lleguemos a superar esas pruebas. Inteligencia Extraterrestre (SETI), el fallecido Carl Durante dentos de generaciones, cada uno de nosotros ha Sagan sugiri6 que el hecho de detectar un mensaje de llevado la dave de la supervivencia como en mensaje dirigido mas aHa de este mundo, servirla como un poderoso de tal manera que, una vez que 10 reconozcamos, no podre- factor unificador en la consciencia humana. mos confundirlo. Quiza en anticipaci6n al dia en que Ia bus- queda de nuestros origenes nos lleve a la esencia de la vida. • En muchos aspectos, el descubrimiento de un 11lf.,'O- 5610 en el descubrimienro y la aceptaci6n de que somos uno saje universal en e1 interior de nuestras celulas po can el mundo, podca revelarse el mensaje. 294 El C6digo de Dios El C6digo de Dios 295 drfa producir eI mismo tipo de union entre personas • Como ciudadanos del mundo, somas mas que las re- de diversas culturas yereeneias. Iigiones, los legados, l~s ereencias. los estilos de vida, • Muehos de los problemas que hieieron que se clasifi- las fronteras 0 las recnologias que nos dividen. En cara al siglo :xx como los "den afios mas sangrien- momentos cuando dudamos de esta verdad inmuta- tos" de Ia historia, han seguido hacia el nuevo milenio. hIe, 10 unieo que neeesiramos para recordarIa es mi- AI mismo tiempo, muehos sienten que las diferen- rar el mensaje que esta en nuestro cuerpo. Este es el cias en religion, Iegado y ereeneias nunea han sido poder del mensaje del interior de nuestras ceIu[as. tan grandes. Ha llegado el momento de aeeptar un profundo mensaje de esperanza unifieadorai alga en Io eua! creer. • Ante la evidenda de la "inhumanidad del hombre", Ia hisroria y la ciencia sugieren que somos basiea- mente una especie de "bondad", aunque en cireuns- taneias extremas, somos eapaees de aetas violentos. • La naturaleza ofrece un modelo de como la unidad y la eooperacion ofrecen una mayor probabilidad de supervivencia que la competencia violenta. La histo- ria humana apoya esta idea. como puede verse en los choques culturales en situaciones como la explora- cion de America del Norte. • La "firma" de Dios, su nombre mas antiguo presente en las eelulas de nuestra especie ofrece un comun denominador sin precedente a partir del eua! resol- ver nuestras diferencias. Tal evidencia tangible ram- bien nos da una razon para creer que la paz puede lograrse y que es valiosa. • Las tradiciones indigenas sabre la soluci6n de con- flictos ofrecen un modelo viable para trascender las diferencias que amenazan nuestra supervivencia como espeCle. ApendiceA EL ORDEN SECRETa DEL ALFABETO ARABE expresado en C6dlgos Numerlcos [Con la autorizaci6n y pot cortesia de David Allen Hulse.]] 'letra Nombre Valor" Letra Nombre' 'Valor , " , de la tetra Numeriro dela Lelra Numerko ;A AU 1 a OVN 70 iB BA 2 F FA 80 :J ]YM 3 5 SAD 90 ;0 DAL 4 Q QAF 100 'tl. HA 5- R RA 200 O~ WAW § Sh ShYN 300 "z ZA ' 7 T TA 400 '1H, HA 8, Th ThA 500 IT TA 9 Kh KhA 600 £ ' , YA 1Q Dh DhAL 700 K KAF 20 D DAD 800 ,1 ' LAM , 30 Tz TzA, 900 M MYM' 40 Ch ChVN 1000 N NWM 50 A HMZ SIN VALOR 5 SYN 60 (Las Ictras dd alfalWl1l Arabe (jue estan subrayadas cotresponden a los mismos \'alorcs tid lIomhn' til' Dins ell d alfaht·tn Ilehn·Il.) 298 El C6digo de Dios : : ; i ~.:: ~ ; ~ . . ~: ; .:. :.:. '. Ape.ndice B LA TABLA PERIODICA de Elementos 300 El C6digo de Dios JA Epfgrafe ApendiceC G;~, 1.008 ' Nombre del Elemento Masa At6mica VIIIH I IVB VB VIS EL NUMERO DE ArOMOS DE HIDROCENO, Nltrogeno, OXlgeno y h Carbono en cadauna n ); ,j de [as cuatTo bases del ADN ""::':';~~"'-\f Nota: Los cuatroelementos del AnN; eI Carbone. el Ox!- gena, et Hidr6geno y el Nit;t6- . geno, se han resaltado con un L a base organica de timina del ADN contiene seis aromos de Hidr6geno, dos aromos de Nirr6geno, dos .homos de sombreado mas oscuro. Ox{geno y cinco aromos de Carbono. * La citosina se compone de diferentes canridades de exacramente los mismos elemen- tos, es decir cinco Hidr6genos, tres Nirr6genos, un Oxlgeno y cuatro Carbonos. Las bases resrantes varian en consecuencia y se indican a continuaci6n. Es as! que es posible que se de un numero extraordinario de diversificaciones, can el simple he- cho de utilizar diferemes arreglos de los mismos cuatro ele- mentos. • NllnlnO de atomm que s(' calcularon de Lebringerr Biochemisuy Tex/- hoof.: (.1 Illnl it,d nl.i IId,n). 1-:1 llr. ') (ldd Ovobil yx WillI tllIl) III i i III n !'B'Ll< j<'lIi d" I., IlIhnlll,l' h'llI, 302 El C6digo de Dios La siguiente tabla ilustra las cuatro bases del ADN y el mimero de atomas para cada elcmento que haee que cada base sea inimitable. ApendiceD ILUSTRACION DETALLADA de (os atomos de H 1drogenoj Nltr6genoj Oxfgeno y Carbono en cada una de las bases del ADN que muestra sus equlvalentes como [etras hebreas ·E n la siguiente tabla en la que se muestran la timina, la citosina, la adenina y la guanina, podemos observar que . las letras 0 elementos que son responsables de su originalidad. ·varian en cada base. Ademas, hacemos la observaci6n de que fa presencia del nombre de Dios dentro del c6digo, como YH ·no siempre garantiza que eI mensaje "dentro del cuerpo" (VG) .esra. contenido dentro de esa porci6n del ADN. Por ejemplo. en la citosina, mientras que YH se repite tres veces en la base, s610 una vez, en el primer caso, es el c6digo que complementa el VG que indica "dentro del cuerpo". Para el 66% del la base de citosina, eI nombre "Eterno" de Dios como YI I simplenwlHt' existc-, sin la cspecificacion dd Illg ar a domk .\C dirigl" 0 InHk I.l Il.Hura!u.1 ctem,l dd \..oc.libo. EI 304 El C6digo de Dios extremo de este e)emplo se puede vet en la adenina, en la que el nombre de Dios ocurre cuatro veces, miemras que en esta base nunea se meneiona la presencia del Eterno dentro del euerpo. 'Hidr6ge~,:" Nitr6geno', :fj,' '. :'2' ,:;-¥, '. (; . . " nxm · :!Jf.tt' .' Notas . Oxigena '. 2 ':t'v '. W ... ~: .\' Carp0110f<:Tutc ',:,. 5 . .~.:: :,.:, , ~.: :G(;(;GC .¥YYYYY Epfgrafe ·..lIJt!ti: ".' 1. Texto tornado de la interpretaci6n artistica de la escritura hebrea he- v:'" . cha por Almaliah Gad. Gad ha disefiado monedas y medallas para el Gc:;;CC gobierno de Israel, a1 igual que el emblema de la Guerra de los Seis . .. . Dfas. Su trabajo esta expuesro en las Galerfas Ahava en Boca Rar6n, Adenina (I\) , Hidr6gem/ .Y .' .5' 'yyyyY. Florida. . Nitfr68eooi ' H 5 '. HHHHH Oxfgeno V 0 "'*"''''*''''''* PRIMERA PARTE Carbona G 5 CCCCG Introducci6n y 5 "Wiyy . 1. Penzias and Wilson's Discovery Is One ofthe Century's Key Advances a~ti~ulo en lInea que induye la biograffa de los investigadores y el H '5 HHHHH signIficado de su descubrimiento. Website: www.beH-labs.com. V 1 V "C" 5, · GGGGC 2. Michio Kaku, Visions: How Science wilt Revolutionize the 21st Century (New York: Anchor Books, 1998), p. 5. A1 aplicar los valores numericos del alfdbeto Hebreo a los elementos d, 3. Entre 1998 y 2000, a1 menos cinco naciones 0 regiones ocupadas nuestro ADN se descubre que la base de toda vida proviene de mal1CLi estuvieron involucradas en conflictos armados. Jeffery Boutwell y directa del antit-,'1.lo nombre de Dios. Michael T. Klare, "A Scourge of Small Arms", Scientific American Gunio 2000), p. 51. . :~~(stJl,rayado) indicae1. aspecto "Etemo" del an- 4. Randall Ingermanson, Ph.D., Who Wrote de Bible Code? A Physicist , tigu~'nombre :de Dio~ Probes the Current Controversy (Colorado Springs: WaterBrook Press, 1999), p. 19. VG (en negritas) indica la'forma en que "La Natu- S. Michio Kakll. IIY/,rfl/,fl"(" A !-i,ientiji, Odyssey Through Parallel lIni- raleza Eterna" reside dentro del cuerpo. wnn. Fimf' \\'{lfl", ,m,1 tI't {i'utlJ {)j WI'lJfWU (:-Jew V, H k; AIH!l"r Ho' ,k'. I 'j'j')), 1'. !X'i. 306 El C6digo de Dios Notas 307 6. Barbara Marx Hubbard, cita de su presentacion The Profet's Confe- 11. R. J. Rummel, "War Isn'tThis Century Biggest Killer," The wan Street rence (Diciembre 2001), en Palm Springs, California. Journal (7 de Julio de 1986). 12. Rummel, Stadistics ofDemocide. Capitulo 1 13. Brzezinski, Out afControl pag. 12. 1. Richard Leakey, ota extraida de un articulo de National Geographic. 14. Informe sobre la epidemia de SIDA con estadisticas globales saca- Febrero de 1998. website www.kirjasto.sei.filleakey. das de UNAIDS: The Joint UN Programme on HIV/AIDS. 2. Eric Hobsbawm, War and Peace en the 20th Century, London Review vyww. unaids.org. afBooks (Febrero 2002). Las estadfsticas de Hobsbawm muestran que 15. Matthew White, Twentieth Century Atlas. Vease: "Worldwide Stadis- para finales de siglo, alrededor de 187 millones de personas (una ean- tics of Casualties, Massacres, Disasters, and Atrocities". [Estadisticas tidad que representa mas dell 0% de la poblaci6n del mundo en 1913). mundiales de bajas de guerra, masacres, desastres yatrocidades.] Estas han perdido la vida en las guerras. e:tad{sti~as se tomaron de un articulo de prensa de la empresa Mu- 3. Zbigniew Brzezinski, Out of Control, Global Turmoil on the Eve of filch Remsurance Company del 20 de Diciembre de 1999. Website: 21 st Century (New York: Simon and Schuster, 1995) pag 12. h rtp:llusers.erols.coml mwhite28/warstatO/htm. 4. Matthew White, Twentieth Century Atlas. Vease "Historical Body 16. Jonathan Steele, "The Century that Murdered Peace", Guardian Un- Count, Selected Death Tools for Wars, Massacres, and Atrocities Be- limited (12 de Diciembre de 1999). Website: iY}VW.guardian.co.uk. fore the 20th Century." Website: http://users.erols.com/mwhite28/ 17. Resumen de las Naciones Unidas sobre las misiones acrivas a favor de warstatO/htm. la paz en 2002, por pals y ano de desarrollo. Para marzo de 2002, 5. Ibidem. contaban con un total de 46,445 policlas profesionales y civiles que 6. Ibidem. representaban 87 naciones; Website: 'WWW.un.org. 7. Brzezinski, Out ofControl pag. 4. 18. Neil Armstrong, cita extralda del ardculo, "Contact, Are We Alond" Florida Today (1999). Website: www.flatoday.com. 8. Terese Pencak Schwartz, "Five Million Forgotten: Non Jewish Victi- 19. Ibidem. ms of the Shoah". EI informe ofidal de los cinco millones de victimas del holocausto que 09 eran de procedencia judia se tomaron de las 20. Ibidem. siguientes fuentes: Richard C.Lucas, The Forgotten Hollocaust(Lexing- 21. Carl Sagan, "The Quest For Extraterrestrial Intelligence." Smithso- ton Univ. Press Kentucky, 1997) y de Stefan Korbonski, The Jews and nian, volumen 1, No.2 (Mayo de 1978). Se debe consultar en Inter- The Poles in World war Two, (New York Hippocrene Books, 1998). net su artkulo que habla de la busqueda de vida extraterrestre. Website: Website: www.remember.org/forgotten/. www.bigear.orglvoll no2Isagan.hrm . 9. Se calcula que 1.2 millones de tibetanos murieron en las dos Meada:; que siguieron allevantamiento en 1959. Lo anterior representa 1a quin- CapitUlo 2 ta parte de la poblaci6n de la region y quiza no se hayan tornado en 1. G.Y. Craig and E.]. Jones, A Geological Miscellany (New Jersey: Prin- cuenta quienes murieron en prisiones 0 durante la destrucci6n de ceton Untv. Press, 1982). 6,000 monasterios, remplos y edificios culturales. Website: wwvuiber.coID. 2. Ademas, Hutton sugiere que las fuerzas que carnbian la correza de la Tierra, incluyendo volcanes y ellevamamiemo y hundimiento de con- 10. R. J. Rummel, Stadistics ofDemocide: Genocide and Mass Murder Sin- tinentes, flleron fllerzas que se han mantenido constantes desdc el ce 1900 (Charlottesville: Transaction Publishers and Rutgers Univ" principio de los {it·mpos. A partir del hecho de qlle los proccsos de b 1997). Virginia Cemer for National Security Law, School of Law, Tierra SOil umfi}nnn ;1 Ir;IVl;S dt' largos pcr(odos, Hutton hallfi:rll a Stl University ofYirRinia. 1,·nJl.I: "I pf ill, 11'''' •k 1I111/i"'mitdl'iilnllU/o 308 El C6digo de Dios Notas 309 3. En 1830, las ideas de Hutton se popularizaron gracias al trabajo de . 10. Igor V. Ovchinnikov et al, "Molecular Analysis of Neanderthal DNA ouo cientffico escoces, Charles Lyell, en su obra que ahara se conside- from the Nothern Caucasus," Naturevo1404 (30 de Marzo de 2000), ra dasica: ThePrinciples ofGeology [Los principios de fa geologia]. pag.490. 4. Charles Darwin, 1859. Extraido de "The Galapagos Conservation 11. Articulo de prensa de la Universidad de Glasgow, "Rare Tests on Trust", [Fideicomiso para la Conservaci6n de las islas Galapagos] rc- Neandenthal Infant Sheds Light on Early Human Developmet''' 28 cursos dedicados a preservar y diseminar los descubrimientos de Dar- de Marzo de 2000. Website: www.gla.ac.uk. win en las islas Galapagos. Website: www.gct.Qrg. 12. Los genes del chimpance, cromosomas 12 0 13 corresponden al cro- 5. Los parametros para una altitud superior por 10 comun se consideran mosoma 2 humano. La parte de la secuencia de los genes se tom6 de entre 1,970 y 6,560 metros sobre el nivel del mar, a las alturas supc- Genbank International Nucleotide Sequence Database. Origen en In- riores a estas se les considera como alturas extremas. Aunque se sabc ternet: http://sayer.lab.nig.ac.,ip/ -silverichimp/chromosome-12/rop- que existen aldeas que por 10 comun escln habitadas de forma perma- 1213.html. nente a 6,300 metros sabre el nive1 del mar, son raras las aldeas ell 13, R. Aravello. et ai, "Evidence for an Ancestral Alphoil Domain on the alturas tan elevadas. Long Arm of Human Chromosmoe 2" Human Genetics, vol. 89, no. 6. Tambien se escribe "hombre de Neanderral". Se Ie da este nombre 2 (Mayo, 1992), pp. 247-9. par eI valle en que se descubri6: Neanderthal, Alemania. Ambas fOf- A continuad6n se incluye un extracto de este articulo: "Como se mas son correctas. supone que eI cromosoma humano 2 se origin6 por fa fUsiOn telomeri- 7. A menos que se indique de otra manera, estas fechas se sacaron de ca de dos CTomosomas ancestraks en los primates, estos hallazgos indican "Special Edition of Scientific American" [Edici6n especial del cientl- que se han conservado no s610 las secuencias telometicas, sino tam- fico americana], (voiumen 12, no. 2) que se public6 en julio de 2003, bien las antiguas secuencias centromericas (0 al menos las alfoides) [el New Look at Human Evolution [Una nueva mirada ala evoluci6n autor aiiadi61as idlicas]. . humana]. 14. "Origin of Human Chromosome 2: An Ancestral telomere-telomere 8. Los restos fosilizados del origen del Australopitecus abarcan un perio- Fusion," Proceedings of the National Academy of Sciences of the do considerable. Cuando se escribi6 esta ohra, eI especimen mas ami- United States of America m vol. 88, no, 20 (October 15, 1991), pp. guo de esa raza, el Australopitecus anamenis data aproximadamente de 9051-5. 4.1 miUones de afios, mientras que el mas joven, el Australopitecm A continuaci6n se presenta un extracto de este articulo: "Llegamos boisei proviene de 1.4 millones de afios. El especimen que fue conoci- ala conclusi6n que ellocus clonado de los cosmids c8.1 y c29B es la do ampliamente fue el de una joven hembra Australopitecus que se reliquia de una antiguafUsiOn de tewmeros y marca elpunto en qUI! eWs descubri6 cerca de Hadar, Etiopfa en 1974. Can el apodo de "Lucy", antiguos cromosomas de simios sefusionaron para dar origm at cromoso- fue el especimen mas completo del Australopitecus ala fecha. ma 2 humano" [eI autor afiadi6Iasitalicas]. 9. S. J. Gould y N. Eldridge, "Punctuated Equilibria: The Tempo and 15. Don Lindsay, "An Inversion Between Man and Chimpanzee Chro- Mode of Evolution Reconsidered", Paleobiology, Vol. 3 pp. 115-] 51 , mosomes." [Una inversi6n entre cromosomas del hombre y de chim- Por primera vt::Z en mas de un siglo, la teorIa de la evoluci6n de Dar pance]. Una descripci6n y diagrama no ttcnicos de genes identicos win fue puesta a prueba par una alternativa viable conocida com< 1 que se localiZ\ln en el ADN de humanos y chimpances. Esta sencilla Punctuated Equilibrium. Propuesta por Niles Eldridge y Stephen J;IJ referencia se puede obtener en Internet: www.C$,colorado.edu.l-lind- Gould, la tcoda sugiere "que en lugar de un movimiento lento y COil saylcreatiQn/inversion.html. tinuo, la evoluci6n se caracteriza por largos periodos de estatici(bd 16. 1.5.B. Leakey, ArrhurT. Hopwood and Hans Reck, "Age of the 01- virtual ('equilibrium'), 'acentuados' por veloces episodios de forml' d(May Bone Beds, Tanganyinka Territory", Nature, volumen 128, no. nuevas". :nH (2-1 dt· Ouuhre dl' 19:11). pag. 724_ 310 EI C6digo de Dios Notas 311 17. Ibidem, paginas 239-244. vida fueron fuenemente rechazados y finalmeme excluidos de las en- 18. Richard E Dickerson and Irvng Geis, Chemistry, Matter, and the Uni- sefianzas cristianas. Gracias a descubrimiemos como la Biblioecca Nag verse: An Integrated Approach to General Chemistry (Menlo Park, CA.: Hammadi, y a libros diflciles de conseguir como El Evangelio de Ma- W.A. Benjamin, 1976), pag. 724. rfa, el Apocalfpsis Ad4n, y el Libra de Enoch, sobreviven hoy como 19. Frank Crane, The Lost Books ofthe Bible and the Forgotten Books of testamento de la extensa sabidurfa gn6stica y su dedicad6n en cuanto Eden (New York: New American Library, 1963). a preservar las ensefianzas erernas para futuras generaciones. 20. Dickerson and Geis, Chemistry, Matter. and the Universe, pag. 529. 8. The Book ofEnoch the Prophet, traducido por Richard Laurance de un manuscrito egipcio de la Bibliotcca Bodleian. (San Diego: Wizards 21. Darwin, The Origin of Species, pag. 168. Bookshelf, 1983), pag. iv. 22. Francis Crick, Lift Itself(New York: Simon and Schuster, 1981), 9. Ibidem, paginas iv-v. pag.88. IO.Ibidem, pag. vii. CapitUlo 3 11. Ibidem, capitulo I, verso 1, pag. 1. 1. Hay una camidad de referencias excelentes de la vida, historia y ense- 12. Ibidem, capitulo LXIII, verso 1, pag. 77. fianzas de Baal Shem Tov y su transici6n a partir de Israel ben Eliezer. 13. Ibidem, capitulo IX, verso 5, pag. 9. Las siguientes referendas pertenecen espedalmente a su rdad6n con 14. Ibidem, capItulo LXVIII, verso 7, pag. 85. ellibra Book ofAdam [Libra de Adam]. Baal Shem Tov Foundation. 15. Ibidem, capItulo XLI, verso 2, pag. 46. Website: www.baalshemtov.com 16. Ibidem, capitulo XLII, verso 1-2, pag. 47, 2. Crane, The Lost Books ofthe Bible and the Forgotten Books ofEden, pag.13. 17, The Other Bible:1ncientAlternative Scriptures, editado por Willis Barn- stone, (California: Harper San Francisco, 1984), pag. 25. 3. Ibidem, pag. 14 18. Ibidem. 4. Ibidem, pag. 11 19. Ibidem, pag. 26. 5. Hershel Shanks, TheMystery andMeaning ofthe Dead Sea Scrolls (New York: Random House, 1998) 20. Sepher Yetzirah: The Book 0fC1'(ation, editado poe Aryeh Kaplan, (York Beach, ME: Samuel Weiser, 1997), pag. xvi. 6. The DeadSea Scrolls traducci6n y comentarios de Michael Wise, Martin Abegg, Jr, and Eduard Cook (California: Harpers San Francisco, 1996), 21. Ibidem, verso I: 1, pag. 5, pag.8. 22. Ibidem, verso 2:2, pag. 100. 7. James M. Robinson, publicado por The Nag Hammadi Library tradu- 23. Ibidem, verso 1:1, pag. 22. cido y presentado por los integrantes del Proyecto C6ptico Gn6stico 24. Karen Armstrong A History of God: The 4000- Year Quest Judaism, de la Biblioteca del Instituto de Antiguedad y Cristiandad, Clan:- Chistianity and Islam, (New York: Alfred A. Knopf, 1993), pag. 216. mont, California (Harper San Francisco, 1990). 25. Sepher Yetzirah, pag. xxv. La Biblioteea Nag Hammadi data del siglo IV de nuestra era y 26. Ibidem. comienza mas 0 menos cuando terminaton los manuscritos del Mal Muerto. La tradiei6n gn6stica se inici6 cuando la doctrina cristian.l SEGUNDA PARTE fue reformada y definida. AI idemificarse con las ensefianzas tal y como las hablan preservado las generacioncs ameriores, los gn6stko\ CapitUlo 4 escogicron separarse y honrar la rradici6n original, en lugar dl' segllil !. T/Jr O'ha HiM(,. "Thl" (:l'c:lIion of Adam," p:igina 26. 1.1 tl·lllll'llli.1 'Ill" ILl},la ("\1;\[,1('(;,1" b I!Jl'-\l~1. SIl\ <,\nlWLI\ y n l i!t> ,I. .' - II't' 11,,/), ()UUII, ,',', I..", l<'ll \' l' 'llkfll.ll Itl\ de r..,1.ud.llla 1\1,111;1111111... 1 312 El C6digo de Dios Notas 313 Ali, capItulo 22, secci6n 1, verso 5 (Columbus, OH: Ahmadiyyah 15. Ibidem, verso 7, pagina 289. Anjuman Isha'at Islam Lahore, 1995), pagina 648. 16. Ibidem, capItulo, 3, verso 4, pagina 145. 3. Ibidem, capitulo 25, secci6n 5, verso 54, pagina 705. 17. Ibidem, verso 7, pagina 152. 4. Ibidem, capItulo 22, secci6n 1, verso 5, pagina 648. 18. Ibidem, verso 8, pagina 154. 5. The Torah, A Modern Commentary, editado por W. Gunther Plaut. 19. Ibidem, verso 9, pagina 155. (New York: Union of American Hebrew Congregations, 1981), Ge- 20. Ibidem, ap~ndiee 1, capitulo 2, verso 2, pagina. 286. nesis 2:7, pagina 29, 21. "Prayer HeIps Patients Heal," United Press International (1999). De 6. Manly P. Hall, The Secret Teaching ofAIIAges: An EncyckJpedic Outline Internet se reportan estudios comparativos de recuperaci6n y resulta- ofMasonic, Hermetic, Qabbalist and Rosicrucian SymboLical Philoso- dos de enfermos por quienes se rez6 y aquellos por quienes no se fez6. phy, (Los Angeles: The Philosophical Research Society, 1988) CLIIL Website: www.appleshearth.com/prayerhelpsl.html. 7. Roger Bacon (1214-1294, Ingeniero Quimico), se Ie considera el al- 22. Ibidem, pagina 1. quimista "verdadero" de la Europa medieval, Fue monje franciscano y sus trabajos 10 llevaron a esta conelusi6n: "La ciencia experimental.., 23. Kaku, Visiones, pagina 4. revela verdades que el razonamiento de los principios generales nunca 24. En enero de 1958 como parte del Afio Geoffsico Internadonal, Esta- ha descubieno" . dos Unidos lanz6 su primer satelite, el Explorer 1, para reunir infor- 8. Se desconoce la ubicaci6n actual de las "Tablas esmeralda de Thoth" y maci6n sobre nuestra atm6sfera y la Tierra. Por media de los de las "Tablas esmeralda de Hermes" que fueron posteriores. Los instrumentos a bordo del Explorer, los ciendficos obtuvieron un pa- escudiosos consideran que tal vez estaban entre los 532,000 docu- norama nuevo de la composid6n de la atm6sfera, los oceanos y con- mentos que se perdieron wando la 'Gran biblioteca de Alejandrfa' fue tinentes de la Tierra. destruida por el fuego en el afio 48 a.c. Antes de este incendio, eI 25. La composici6n espedfica de nuestra atm6sfera puede variar debido a historiador romano Kallimachos mencion6 que todo eI conocimien- factores de temperatura y elevaci6n. En general, 1a atm6sfera de la [Q de la civilizaci6n griega, 10 que induye astronomia, medicina, cien- Tierra esta compuesta de 78% de Nitr6geno y 21 % de OxIgeno. En cia y filosofia, habia sido registrada y almacenada en esa biblioteca, la secci6n de "Compasici6n de la atm6sfera", se pueden conseguir 5610 podemos asumir que las revelaciones de Thoth se encontraban referencias sobre la NASA. Website:http://liftoff.msfc.nasa.gov/aca- entre esos documentos. demylspace/atmosphere/.html 9. Z' ev ben Shimon Halevi, IVzbbalah: Tradition ofHidden Knowledgt' 26. Aunque la cantidad precisa de oxigeno disuelto en el agua puede va- (New York: Thames and Hudson, 1979), pagina 7. riar a causa de la temperatura y salinidad (agua dulce y salada), la EI Sefirot rodeado con una l£nea de puntos en la parte inmediata proporci6n es similar. De entre un mimero de referencias a la mano, inferior a la corona del Arbol de la Vida, se conoce como d "Sefirm escojo esta en particular porque muestra c6mo se derivan los porcen- opuesto" del conocimiento. Representa. un lugar unico entre los nOID- tajes. El resultado: el agua tiene un porcentaje aproximado de 88.89 bres de Dios en el Arbol, a pesar de que se Ie da un lugar en el, perma- de oxigeno y 11.11 de hidr6geno. Website: www.cit;ycollegiate.com/ nece sin manifestarse en nuestra experiencia de la creaci6n. cbarteda,htm. 10. Sepher Yetzirah, apendice I, capitulo 2, verso 2, pagina 286. 27. La composici6n del 98% del Sol esta formada a raz6n de, hidr6geno (71 %) y helio (27.1 %), juntos. Yen pequefias canridades, oXlgeno, 11. Halevi, IVzbbalah, pagina 6, carbona, nitr6geno. silicio, magnesia, noon, hierro y azufre para eI 12. Sepher Yetzirah, capitulo 1, verso 9, pagina 68. porcentaje res t;lIl({', NASA Wehsite: http://imagine.gsfc.nasa.gQv,l 13.Ibidem, apendice 1, capitulo 4, versO 2, pagina 288, d!.)(shlli ;~l rvl;lInwm/961lJl~,hlIJ.11 14, Ibidem, vcr~o () pagina 289, 314 El C6digo de Dios Notas 315 Capitulo 5 6. De hecho, e1 estudio de la gematria podrla set una de las destrezas 1. Aunque los investigadores han logrado encontrar e1 odgen de anti- mas antiguas que existen. De forma casi universal, las tradiciones an- guos alfabetos hasta eI punta en que brotaron de arboles lingiilsticos tiguas han rdacionado las lecras de la mayoela de los alfabetos, 10 que mas anciguos, las rakes precisas del arbol en sf siguen siendo incierras. incluye ingles, griego, laun, COpta, sanscrito, hebreo, arabe, chino, Aunque los arque6logos han recuperado ejemplos de antiguas formas cuneiforme y tibecano, con valores numecicos. Para obtener mas in- de escritura, yestan de acuerdo en quienes hicieron las tabIas, pergami- formaci6n sabre este rema, consultese eI tratado en dos tomos de Hulse, nos y pinturas rupestres de tiempos pasados, el misterio para precisar The Key ofIt All (Vease la referencia 4 anterior). dOnde y cudndo se hicieron los escritos aun permanece. . 7. El usa de gematria para e1 estudio de las rdaciones "ocultas" mas pro- Par el momento y a 10 largo de 5,000 afios, las evidencias parecen fundas entre palabras y frases ha sido reconocida, honrada y practica- sugerir que muchas y diversas lenguas del mundo de hoy surgieron de da por dendficos y fil6sofos par igual, a 10 largo de dentos, si no es una lengua "madre" comun. Por ejemplo, se han establecido enlaces que de miles de atios. Posiblemente d ejemplo mas evidente de la directos entre las antiguas tablas en lenguaje cuneiforme, y los funda- aceptaci6n y estudio de La gematria se relaciona can la denda mfstica mentos del idioma moderno a partir del griego, eI hebreo ye1 fenkio. de la Cabala hebrea. 2. Por ejemplo, en La ciencia de la flska, la letra '1i" es un ejemplo de Los principios de la gematria se pueden explorar a muchos niveIes fonograma. Aquf la letra "E" es un sfmbolo que representa la fuena de significado, mas alIa de la simple suma de los valores de letras y de la "energfa", ademas de todas la implicaciones que las matematfcas numeros, e incluye el uso de valores reducidos, integrales reducidas, y la f[Sica relacionan con la energfa. Hay un fonograma que usa este absolutos y ordinarios. Existe un buen numero de exceIemes tex[Qs simbolo que se ha convenido quizas en la ecuaci6n matematica mas sabre el cerna. Una de las mejores referencias en Internet que conOl- f:kil de reconocer: E " me2 • co, esta patrocinada por el Gal Einai Intitute ofErae/' can informa- Los signos silabicos son sfmbolos que representan la silaba de una ci6n proveniente, de las ensefianzas del Rabino Yitzchak Ginsburgh. palabra de la manera en que se dice. El fallecido J. T. Hooker, profesor Website: www.iriner.orglgematria/gematria.htm emerito de griego y latin de la Universidad de Londres, describe el 8. Rabbi Benjamin Blech, The Secret ofHebrew l%rdr. (New Jersey: Ja- significado de usar slmbolos para representar sflabas como e1 "avance son Aronson, 1991), pagina 129. mas importante en la hisroria de la escritura". J. T. Hooker, Reading 9. The Other Bible, Haggadah, pagina 25. the Past. (London: British Museum, 1990). Los idiomas antiguos, ta- 10. Robert Lawor, Sacred Geometry: Philosophy and Practiet [Filosofla y les como el chino, donde cada palabra es una silaba, hicieron extraor- prdctica de fa geometrfa sagradt] (New York: Thames and Hudson, dinarios avances en su habilidad de preservar detalles hist6ricos por 1982), pagina 9. medio del usa de signos siiabicos. Una vex mas, en el idioma ingles, d idioma cientlfico da un ejemplo de signa silabico, la constante mace- 1L Ibidem, pagina 10. matica "pi" (n). Aquf el slmbolo es una palabra completa y se usa para 12. Michael Drosnin, The Bible Code (New York: Simon and Schuster. representar una relaci6n entre la circunferencia de un drculo y Sll 1997), pagina 25. diametro. 13. "La masa at6mica" se calcula como la masa de un :.ttomo relativo a un 3. Sepher Yetzirah, apendice 1, capitulo 4, verso 4, pagina 288. doceavo de la masa del carbona 12, la forma de carbona mas 4. David Allen Hulse, The Key of It All: An Eneycwpedic Guide to tbe abundante. . Sacred Languages and Magical Systems of the World, Book Two: Tbl' En la 'Tabla peri6dica de los elementos' (apendice B), a cada ele- \¥'estern Mysteries (Paul, MN: Llewellyn Publications, 1993), pagina~ memo se Ie asigna el valor de masa ar6mica. (Aunque por 10 eomun 461- 538. los rtrminos mam atOmic'a y peso nt6mico se usan de forma intercam- biablc y los valor....,.. n'bcionados con ~lIos son simibres, de hccho, 1. The American Heritage College Dictionary. Third Fdition, definition .} .lIuh", ,ull I'.n.imc£ I l l ' ,It' prnpinbdt" dlfnclllc~. Peso ;1I{lIlJl<O 'C (New York: llollglllon Mimin {~(lmp.\l\Y. 1')')7), p.igil1;l 1.~21 316 El C6digo de Dios Notas 317 definida como una medida de la fuerza con la que el planeta atrae la r) Yod = 10 masa. 1 + 0 = 1 14. "Materia" se define como algo que acupa espacio y tiene masa. La "masa" describe la inerda de un objeto en maYimiento, y que tan facil En la Tabla Peri6dica hay un elemento espedfico con el valor absoluto puede recibir una influencia a ser detenido. Par ejemplo, un ave que que corresponde al "'1" de Yod: el elemento es nitr6geno. yuela a 14 kil6metros por hom puede reeibir can facilidad la influen- Hidrogeno cia de una brisa; se diee que el ave tiene una masa pequefia. Sin em- bargo, la brisa no dene ningun efeeto en un tanque militar blindado A.M. 1.008 que viaja ala misma veloeidad. En este caso se dice que la maso. del Numero absoluto (valor integral) = 1 tanque es mayor que la del ave. En 10 que respeeta a la qufmica, cuan- do preguntamos "eminto" de algo esta presente, de hecho estamos A traves de un proceso similar, descubrimos una igualdad entre la letra preguntando, (Cual es 1a masi' de ese alga? Hey y el elemento nitrogeno (valor 5), y la letra Wlv y oxlgeno (valor de 6). 15. A continuaci6n esta la dave de las caraetedsticas que hacen que los 20. Sepher Yetzirah, capftulo 1, verso 12, pagina 77. elementos de la Tabla Peri6dica de los Elementos sea uniea. De las 17 21. Un principia que se usa en la 16gica para tomar una decisi6n de entre posibilidades, s610 una caractedstica une los elementos mas abundan- varias explicaciones cientificas cuando dos 0 mas posibilidades escln tes del universo con el numero del valor oeulto de la antigua alqui- en juego. El nombre se atribuye a William Occam, un fi16sofo medie- mia. Esa dave es 1a caracteristica de la maso. o.t6mica. val, y a menudo se Ie llama principia de la parsimonia. En general, el Caractedsticas dave que hacen unico a cada elemento principio establece que "uno siempre debeda escoger la ex.plicaci6n m:is simple para poner en daro un fen6meno, la ex.plicadon que re- Numero at6mico Capas at6mieas Punta de fusi6n quiera las minimos modificadones de logiea". Website: http:// Electro-negatividad Radio atomico Ionizacion potencial pespmcl.vub.ac.be/asciPRINCI SIMPL.html Densidad Peso at6mieo Masa at6mica Punco de ebullici6n Radio covalente Calor espedfico 22. Dickerson and Geis, Chemistry Matter, andthe Universe, grafica inte- Estados de oxidaei6n Calor de fusi6n Termal rior de la portada de la edician en pasta dura. Conductividad Calor de evaporad6n Trama orbital Es interesante que cuando se campara la abundancia de los cuatro elementos en el universo, el cuerpo humano tiende a comparcir los 16. Sepher Yetzirah, capftulo I, verso 13, pagina 80. En la version de Saa- elementos en coneentradones que son mucho mas mareadas que en dia del Sepher Yetzirah, encontramos las tres Letras Madres que se el mundo que nos rodea. (De Dickerson and Geis, Chemistry Matter, mencionan inmediatamente en el primer capftulo. AlIi se hace una and the Universe, pagina 165.) distind6n entre las Madres Basicas, las Dobies y los Elementos. "Veintidns letras, una base de tres bdsicas, sietl! ABUNDANCIA DE LOS ELEMENTOS EN dobles y doee elementos. " "Las tres bdsicas son A,M, Sh... " EL UNIVERSO Y EN EL CUERPO HUMANO "Las sietedobles son E, G, D, K, R R, T..." "Las doce (Los valores se muestran como atomas par 100,000) elementales son H, V, Z, CH, T, Y, L, N, S, Tz, Q." [EI autor afiadio comas para facilitar la lectura.] Element Presencia en todo el universo Cuerpo humano 17. Ibidem, pagina 140. Hidr6geno 92.760 60.560 18. Ibidem. Nirr6geno 1') 2.440 19. Usando los prineipios de gematria, se enCOl){fO que Ia letra hchrc;1 Oxfgello 4'} 2S.670 Vod !'t'Slle!V{" ("I v;llor dl' J, ( '.1£ 1>"11" K IONW 318 El C6digo de Dios Notas 319 Capitulo 6 rifled Fragments, Discoveries in the Judean Desen XXXIII (England: 1. Golden Treasury ofBible Stories, Arthur Whitfield Spaulding, editado Oxford Univ. Press 2001), Plates, Plate XIX, fragmento numero 6. pOt: Nashville: Southern Publising, 1954. Fragmento de un pergamino con el nombre de YHVH. Aunque este no es el unico caso en que eI nombre antiguo de Dios aparece en 2. Halevi, Kabbalah, pa-gina 5. un fragmento de pergamino, es uno de los mejores ejemplos que pude 3. Tanakh: The Holy Scriptures (Philadelphia Spaulding Publications So- encontrar, as! como uno de los mas antiguos. Esta fotografla se pre- ciety, 1985), Antigua Testamento, Exodo 3: 14, pagina 88. sem6 en el ano 2001 como parte de la serie de tomos de documentos 4. Halevi, Kabbalah, pagina 9. que respaldan el contenido de los hallazgos del Mar Mueno. Esta 5. Zohar: The Book ofSplendor, editado por Gershom Scholem, (New fotografla se presenta par cortesfa de la Universidad de Oxford. York: Schoken Books, 1949), pagina 3. 21. Hershel Shanks, "Publishing Every Last Fragment" Biblical Archaeo- 6. Sepher Yetzirah, pagina 5. logy Review (Marzo - Abril del 2002): pagina 6. 7. Tanakh, Antigua Testamento, :b:odo, 3:13. pagina 88. 22. Ibidem, apendice 1, capitulo 2, verso 2, pagina 286. 8. Antigua Testamento, comentarios a "The Divine Name Ehyeh," pa- 23. Sepher Yetzirah, apendice 1, capitulo I, verso 1 pagina 285. gina 405. 24. Antigua Testamento, comentarios a "Linguistic Excursus on the Name 9. Ibidem, Exodo 3:15 poigina 400. YHVH," pagina 426. 10. Ibidem, nota a.I pie de pagina 4, pagina 405. 25. Ibidem. 11. Ibidem, comentarios a "My Name YHVH," paginas 424 - 425. 26. Sepher Yetzirah, pagina IS. 12. Ibidem, comentarios a "Hidden" pagina 408. 27. Antiguo Testamento, txod? ,15:2, pagina 488. l3.Ibidem. 28. The Other Bible, Haggadah, pagina 32, 14. The New Jerusalem Bible: The Complete Text ofThe Ancient Canon of 29. Sepher Yetzirah, paginas 19 ~ 22. The Sriptures, Standard Edition 30. Ibidem, capitulo 2, verso 2, pagina 100. (New York: Doubleday, 1999), txodo 20:7, pagina 70. 31. Articulo de prensa de la NASA, "Hubble Reads Age of Universe." 15. A YHVH tambien se Ie conoce como Tetragrammaton, una descrip- Spaceflight Now (2002). ci6n que proviene del idioma griego que literalmente significa "pala- 32.J. D. Watson and F. H, C. Crick, A Structure for Deoxyribose Nu- bra de cuatro letras". cleicAcid." Nature, volumen 171 (Abril 1953) pagina 737. 16. Antiguo Testamento, comemarios a "Linguistic Excursus on the Namt· 33, Roberth Write, Time 100: Scientists and Thinkers-James Watson and YHVH," pagina 426. Francis Crick. The Time Archive, 1, Website: www.time.com/time/ 17. Esta foro muestra una secci6n del pergamino que se preserv6 de for- Ii mel OO/sdCOtist/watsoncrick,html ma extraordinaria en la Cueva 1, "El primer pergamino Isaiah" (1 Qisa). 34. EI presidenee Clinton "anuncia que concluy6 d primer estudio sabre EI documemo tiene 8 metros de largo y en esta diapositiva se mues- la totalidad del genoma humano", en una confereneia de prensa de la tran desplegadas las columnas que contienen el texto de Isaiah 38:8 <l Casa Blanca de junia 26 del 2002. 40:28 de un extrema at otro. [FotografCa de John Trevor.] 35. Mas alia del akance que se necesiea para enfocar este texeo, la clave 18. Antiguo Testamento 6:3, pagina 426. para entender el arreglo de las bases en esea helice, es que la secuencia 19. Sepher Yetzirah, pagina 17. de las bases que avanzan en una direcci6n (formando un lado de la cSLalera), son los complcmemos de la secuencia al oero lado de la mis- 20. Dana M. Pike y Andrew C. Skinner, Qunran Cave 4. XXIII: Unidell IILl, {Illl' ;l\';1I1l;[ ('11 s<'lilido COlllLHi". Yl que ,,('llo dClcrmin;ld:ls hase" 320 El C6digo de Dios Notas 321 pueden formar un par can otras bases, la posibilidad de que se presen- del mensaje que hay en nuestras dlulas podrla verse como una refe- ten errores en el c6digo es minima debido a esta estructura. renda a "denero" 0 al "interior de nuestro cuerpo. 36. De hecho, las cuatro bases del ADN son una especie de taquigraffa, David Allen Hulse es un reconocido experto en el arre de descifrar una abreviatura de los elementos que se representa por medio de k- la relad6n mfstica entre los lenguajes de 1a antigiieciad y su significado tras. Aunque los mismos elementos de Hidr6geno, Nitr6geno, Oxf- nu~erico. The Key ofit All Book One: The Eastern Mysteries, The &y geno y Carbono escan presentes en cada base de ADN, fa cantidad de of It All Book Two: The ~stern Mysteries y Two Dimensions ftrthe eada elemento es 10 que varia. En lugar de avanzar por el tediolio pro- Cube ofSpace (York Beach: Samuel Weiser, 2000), rambien contribu- ceso de escribir en cuantas ocasiones se presenta un elemento en la y6 en el ultimo libro de Israel Regardie, The Complete Golden Dawn base, simplemente se indican can las tetras A, 1; CoG. (Vease tam- System ofMagic {Malasia: Falcon Press, 1984}. bien el apendice C.) 43. A parrir de mi investigaci6n sobre el significado de las letras VG y GV; 37. The Expanded Quotable Einstein, editado por Alice Calaprice (Prince- es obvio que en las tradiciones de fa Cdbala, el orden invertido de las ton, N. J.: Princeton Vniv. Press, 2000) pagina 203. letras podrfa reladonarse con ambitos de la creaci6n alternos 0 "in- versos". EI Sepher Yetzimh, por ejemplo, se refiere a esros ambitos des- 38. Sepher Yetzirah, capilUlo 1, verso 9, pagina 68. cribiendo e1 proceso para combinar cada una de las 22 letras hebreas 39. Antiguo Testamento, comentarios a "Linguistic Excursus on the Name con el resto de las letras del alfabeto, en una secuencia en Ia que no se YHVH," pagina 426. repiten, para crear las 231 posibilidades (Puertas) de la cread6n (Se- 40. Sepher Yetzirah pagina 15. pher Yetzirah, capitulo 2, verso 5, 124). Hulse describe el significado 41. The Amereian Heritage Collage Dictionary, Third Edition, definition de GVNG como 1a Puerta 44 de la Creaci6n. Aqui el valor de la 1, pagina 471. puerta en c6digo es OM, que significa "sangre" en hebreo, y fa raiz de la palabra que se refiere al primer hombre de nuestra espede, ADM 42. Las siguienres referencias provienen de mis charlas y correspondencia (Adan). ' con el erudito y aurar David Allan Husle. En relaci6n al orden de las letras hebreas como numeros el establece: "Desde el punta de vista 44. Cada base de ADN contiene un grado diferente de "dentro del cuer- numerico, no hay ninguna diferencia en el orden de las letras he- po". Por ejemplo, en la base de timina (T) hay seis aromos de hidr6- breas." En vista de que cada letra se relaciona con un valor numerico, geno, dos de nitr6geno, dos de oxfgeno y cinco de carbona. asi como 2 mas 1 cia el mismo resultado que 1 mas 2, debemos consi- Considerando cada elemento desde la perspectiva de las tetras he- derar que VG en nuestro DNA es 10 mismo que GY. breas, en la timina el aspecto de "DiosJEterno" s610 se completa dos En hebreo, GV tiene varias traduceiones posibles, rodas con el mis- veces como VG, que significa "dentro del cuerpo". Et resto de la base rna tema general; GV se traduce como "espalda", "espina dorsal" 0 es 5610 el aspecto Y y G del c6digo. (Ver el Apendice D que ilustra este "interior del cuerpo". Hulse ofrece ejemplos de esto en un contexto principia.) b'blico en el que GV significa "espina dorsal" (Ezequiel, 23:35) 0 en un contexto donde significa "interior del cuerpo" Gob 30:5). La ge- TERCERA PARTE matrfa de esca palabra y de la palabra hebrea para ''Adan'' revela una Capitulo 7 relaci6n interesante y elocuente. La suma de los valores de GVes 9 [(; 1. Blech, The s,ecrets ofHebrew WOnis, p. 22. (3) + V (6) '" 9]. Este es el mismo valor del nombre que representa al 2. Gregg Braden, The Isaiah Effiet: Decoding the Lost Science ofPrayer primer hombre de nuestra especie, fuMn (A", 1 + 0 '" 4 + M '" 40, nos and Prophesy (New York: Harmony Books, 2000), pp. 187-192. cia 45 que se reduce a 9). Baja la perspecriva de esta profunda relaci611 revelada por el numero, el cuerpo de nuestras especies, y el VG/GV 3. Rollin McCarty, Mike Atkinson, William Tiller, Glen Rein, and Alan de nuesrras celulas describe 10 mismo. Por tanto, las dos ultimas letta\ D. Watkins. "Thl' Effects of Emotions on Short term Power Spec- 322 El C6digo de Dios Notas 323 trum Analysis of Hean Rate Variability, The AmericanJournal ofCar- 21. Ibidem, p. 77. diology, vol. 76, no. 14 (Noviembre 15,1995): pp. I089~1093. 22. Ibidem, Haggadah, p. 25. 4. Rollin McCarty, M, A., Bob Barrios. Choplin, Ph.D. Deborah Roz- 23. Ibidem. man, PhD., Mike Atkinson, and Alan Watkins, "The Impact of a 24. Ibidem. New Emotional Self-Management Program on Stress, Emotions Hert Variability, DHEA and Cortisol," Integrative Physiological and Beha- 25. Holy Bible: Authorized King James ~rsion, Genesis 2:7 (Grand Ra- vioral Science, vol 33, no. 2 (1998): pp. 151-170. pids, MI: World Publishing, 1989), p. 2. 5. "Rough Map of Human Genome Completed," CNNcom Health, Ju- 26. The Other Bible, Haggadah, p. 25. nia 26,2000, 1-2. Website: www.cnn.com. 27. Ibidem, p. 26. 6. Tom Abate, "Genome Discovery Shocks Scienitsts," San Francisco 28. Braden, The Isaiah Efficf, pp. 207-211 and 233-238. Chronicle (February 11, 2001): p. A-I. Website: www.sfgate.com. 29. Santa Biblfa, Juan, 2:21, p. 67 7. Ibidem. 30. Ibidem, Corintios, 3: 16, p. 119 8. Ibidem, 31. Ibidem, capitulo 6, verso 19, p. 121 9. Ibidem. 32. Dickerson and Geis, Chemistry, Matter; and the Universe, p. 529. 10. Ibidem. 33. Ibidem, p. 529. 11. Stephen Hawking citado en la revista Der Spiegel en 1989. El texto 34. Crick, Lift Itself, p. 88. original esta en aleman. Como no pude conseguir un ejemplar en 35. Sir Fred Hoyle and Chandra Wickramasinghe, Evolution.from Space ingles, esto se tom6 de una fuente en linea de sus pensamientos, citas (New York: Sim~n and Schuster, 1981), pp. 23-27. y filosofia. Website: www.nobeliefs.com/great-quotes.htm. 36. James D. Watson, The Molecular Biology ofthe Gene (Menlo Park: 12. Bose-Einstein Condensate Homepage: a new form of matter at the w.A. Benjamin, 1977). coldest temperatures in the universe. Website: www.colorado.edu/phy- 37. Ibidem, p. 69. sicsl2000/bec. 13. "Scientists Conquer User Beam Tdeportation:' Australian BraodLasting 38. The Expanded Quotable Einstein, p. 208. Corporation Online, Sci-Tech, Junia 18, 2002. Website: 39. Graham Hancock, The Mars Afystery: The Secret Connection Between www.abc.net.au. Earth and the Red Planet (New York: Crown Publishers, 1998), pp. 73-78. 14. Comunicado de prensa, "Geneva Universiry Development in Photon Entanglement for Enhanced Ecryption Security and Quantum Com- 40. Richard Hoagland, Hoagland's Mars: Volume IL The Un Breifing, The puters," Department of Physics, Geneva University, 2001. Websitt:: Terrestrial Connection (video) (New York: B.c. Video, 1992). . www.geneva.ch/entanglemenr.htm. 41. Blech, The Secrets ofHebrew W0rdr, p. 143. 15. Braden, The Isaiah Effect, pp. 89~93. 42. Ibidem. 16. The NewJerusalem Bible, Standard Edition, Zechariah, 12: I ,p. 1100. 43. Ibidem, 23. 17. Ibidem, Ezekiel 36:27, p. 1006. 18. The Other Bible, Mandean Gnosticism, "Creation of the World and Capitulo 8 Alien Man", p. 134. 1. Crcmo and Thompson, The Hidden History ofthe Human Race, Sum- 19. Ihidem, p. 136. mary and Anolll~l1om Fvidl'IKl' Related 10 Human Anriquiry, pp. 267- DR. }o. Ihidl'lll. C<lIllIlH'nLny. J.TIl\' I !V[)mLI'~' of rhl' /1.[, lIon,," 1'. }'). 324 El C6digo de Dies Netas 325 2. "Son mas los adolescentes que han perdido la vida en accidentes auto- dios desputs de su aparici6n en el Servicio Postal de los Estados Uni- moviHsticos durante los ultimos diez afios que los soldados que mu- dos en el 2001. Qrros [ienen nornbres que rara vez se escuchan y son rieron en la Guerra de Vietnam." En la Guerra de Vietnam perdieron mas difkiles de pronunciar. Los Centros para e1 control y prevenci6n la vida aproximadamente 58,000 soldados, pero 60,000 jovenes per- de enfermedades en Esrados Unidos [U.S. Centers for Disease Con- dieron la vida en accidentes auromovilisticos en los ultimos 10 mos. trol and Prevention (DCD)] mendonan al menos 16 susrancias que Fuente: ~Estoy segura? (Programa para la seguridad de conductores representan una amenaza en caso de un ataque bio16gico al pals. In- adolescentes) Website: www.AmISafe.net. duyen agentes nerviosos como el Sarin y el XV, agentes que produ- 3. Barbara Marx Hubbard, cita en el escenario de The Prophet's Confe- cen Ilagas como el gas mostaza, y agentes psicoacrivos como d Agente rence (Didembre 2001), Palm Springs, California. 15, ademas de las toxinas bacteriales y virales de botuJismo, Aflotoxi- 4. Comunicado de prensa, "New Century to Be Marked by Growing nas. (venenos que producen cancer), bacterias que producen gangre- threats, Opportunities, "WorJdwatch Institute CEnero 16, 1999). Web- '! na ~trax. La agenda tiene tambh~n una lista detallada de agentes qUImlcos. site: www.worldwatch.org. 5. Stanislav Grof, M.D., "Consciousness Evolution and Planetary Sur- 17. La Convencion de Armas Qulmicas, conocida forrnalmente como vival: The Psychological Roots of Human Violence and Greed.". Ex- C~nvention on the Prohibition, Production, Stockpiling and Use ofChe- tracto del documento presentado en la Tercera Conferencia mtcal Weapons and Their Destruction [Convencion sobre fa prohibicion, Transpersonal sobre d terna de la Espiritualidad, la Ecologia y la Sabi- produccion, almacenamiento y uso de armas quimicas y su destruccion]. durfa Nativa, Killarney, Irlanda, Junio de 1995, se conduy6 en 1993 y fue firmada por 159 estados en 1995. Ademas de agentes qulmicos y bio16gicos, este tratado internacional rrata el 6. Ibidem, p. 3. tema de tecnologfas nucleares y el desarrollo de misiles que tambien 7. Carl Sagan, "The Quest For Extraterrestrial Intelligence." Smithso- podrfan utilizarse como sistemas de transporte, La siguiente es una nian, vol. 1, no. 2 (May 1778). referenda en linea at documento en sf. Harvard Susex Program on 8. Ibidem, p. 12. CBWArmamenr and Arms Limitation Website: www.fas.harvard.edu/ - hsp I chemical. hEmi. 9. Ibidem,p. 13. 10. "When to Jump In: the World's Other Wars," Time (Abril 19, 1999), 18. The Expanded Quotable Einstein, p. 18]. p.30. 19, Existen varias traducdones del Mahabbaratah. Debido a su gran ta- 11. Monty G. Marshall, Director, Center for Systematic Peace, "Major mafio, (mas de 100,000 versos), las traducciones por 10 general se Episodes of Political VioUence 1946-1999." Los cuadros describen publican pOf secciones, yel Bhagabad-Gita es la mas conocida. Las 291 episodios de conflictos armados en d mundo entre 1946y 1999. dtas que urilizo son del autor e investigador David Hatcher Chul- Website: www.members.aol.com/CSPmgm(warlist.htm. dre.ss, y se refieren a la rraducci6n de Charles Berlitz y a Sll libro Mys- term ofForgotten Worlds [Misterios de mundoJ olvidados] (New York: 12. Samuel P. Huntington. "The Age of Muslim Wars," Newsweek, vol. Doubleday. 1972). 138, no. 25 (Diciembre, 17,2001) pp. 4-9. Childress, que ha sido investigador y explorador durante mucho 13. Jorgen Wouters, "The World's War Machine." ABCNEWS.com, Abril [i,cmpo, ha reunido una cantidad impresionante de evidencia que su- 22,1998. glere que en el·pasado han existido formas avanzadas de tecnologla, 10 14. Ibidem. que induye su libro Technology ofthe Gods: The Incredible Scienm of 15. Ibidem. the Ancients (Adventures Unlimited Press, 2000). Para quienes se intcn:sen en leer sccciones del texw en sf, una de 16. Algunos de estos agentes, como la bacteria de Ann-ax, se han conVt·! I~s mt'jores tradun-iones <piC he encontrado es d tr;lbajo de Pratap tido en terminos familiares debido a la amplia cobertura de los lilt' <h:1I1dr Hoy, l hl.l lUll!' ,!c \11.\ !I':ldlHCiollt'S S<' plink vn deClfl'llli 326 El C6digo de Dios Notas 327 camente para prop6sitos academicos y de investigaci6n (no comer- 33. Ibidem, p. 94. cial), de rnanera espedfica, las paginas 446-447, y 481-489 en 34. Darwin, DucentofMan, p. 110. www.abob.libs.uga.edufbobklmahalmahbfr.html. 35. Peter Kropotkin, Mutual Aid: A Factor ofEvolution (Boston, MA.: 20. Ibidem. Porter Sargent Publishers, 1902), p. 14. 21. Ibidem. 36. Dr. John Swomley, "Violence: Competition or Cooperation," Chris- 22. Ibidem. tian Ethics Today 26. vol 6, no. 1 (Fehrero 2000): p. 20, 23. Ibidem. 37. Ibidem. 24. "The American Experience: Race for the Superbomb," escrito, pro- 38. Discurso de apertura en eI Simposio sobre los Aspectos Humanisticos ducido y dirigido por Thomas Ort. Este programa se transmiti6 por del Desarrollo Regional. ProutJournal, vol. 6, no. 3 (Septiembre 1993). primera vez en el Public Broadcasting System en enero de 1999. Se 39. Ibidem. pueden conseguir transcripciones en el Website: www.PBS.org. 40, Kaku, Vtsiom. pp. 322-330. 25. Frederick Soddy, Nobel Prize in Chemistry, 1921, Th~ Interpretation afRadium (1909). 41. Ibidem, p. 329. 26. Se han publicado informes de numerosos descubrimientos de arena 42, Jean Houston, cita en el escenario de The Prophet's Conftrence {Confi- de desiertos fundida y transformada en vidrio de alta calidad, por rencia tkl Profeta} (Diciembre 2001), Palm Springs, California. ejemplo: Giles Wright, "The Riddle of the Sands", New Scientist Uu- Iio 10, 1999); Margareta Casson, Rocks and Minerals no. 396 (1972); Capitulo 9 Chaildress, Technology ofthe Gods. I. Narional Atmospheric and Armopheric Administration (NOAA), base Un extracto representativo de estos estudios puede verse en de dato-s sobre el clima y registro sobre incendios. National Climatic www.world-mysteries.com/pex_6.htm. Data Center. Website: www.ncdc.noaa,gov!oa!reporrs/weather- 27. Sir John Marxhal, Mohenho-Daro and the Indus Civilization (Vol. 3, ey ents,html#HISTORICAL. 1931). 2. Sagan, "The Quest For Extraterrestrial Intelligence." 28. Sir Mortimer Wheeler, The Indus Civilization (3d ed. 1968). 3. Ibidem 29. Peter N. Stearns, MichaelAdas, Stuart R. Schwartz, World Civilizatiom: 4. Ibidem The Origins ofCivilizations. 5. Ibidem 30. A. Gorbovsky, Riddles ofAncient History (Moscow: Soviet Publishers, 6. Santo Tomas de Aquino, Summa Contra Gentiles, Vol. II, p. 45. Cirado 1966), p. 28. . por Arthur O. Lovejoy, Thf! Great Chain ofBeing: A Study ofthe His- Aunque no pude encontrar la fuente original de ~sta afirmaclon, tory ofan Itka (Cambridge, MA: Harvard Univ. Press, 1936), p. 76. send que era importante incluirla en el texto, pues se Clta con frecuen- cia en libros y an£Culos. Sigue la linea de otros historiadores respeta- 7. Esta cita se tom6 de la obra disica de Francis Bacon sobre la natu- dos, como Kisari Mohan Ganguli, que opinan que los escritos antiguo~ raleza humana, OfGoodnes and Goodness ofNature. {Sobre La bondad de la India describen una batalla en la que se usaron armas basadas ell y fa bonJad. tk fa naturaleza}, este capitulo en particular, "Ensayos, ciencia de nivel avanzado. Civiles y Morales" (Capitulo XIII), se puede consultar en Internet como parte de Ia serie Harvard Classic; (1909-1914). Website: 31. Ibidem. www.bartlehy.com/3/1/I3.html 32. Ian K. Steele, Warpaths: Invasions ofNorth America (Oxford: Oxford 8. Abraham H. M;lslow, adaptado de la introducci6n del ediror ala [er- Univ. Press, 1994), p. 94. ccr;l njjei6n dd lihro '!i/tl"trr! fhl' 1~ly(II(!/(!g"y o(Ht'ing (So/m- ttl priw!o g/d tit' ,,.,-j (Nt·w )'''1 k W'dey. I ')')'l). 328 El C6digo de Dios 9. Ibidem. 10. "Prague Faces 'Worst Moment,'» CNN .com/World, Auguts 14, 2002. Website: www.cnn.com. 11. "Obesity Trends: Prevalence Among U.S. Adults, by Characteristics," repored by the Centers for Disease Cantrol, National Center for Chro- nic Disease Prevention and Health Promotion, Statistics from A.H. Modkad, M. Serdula, and W. Dietz, "The Continuing Epidemics of Obesity and Diabetes in [he United States." journal of the American RECONOCIMIENTOS MedicalAssociation, vol. 286 (Septiembre 12, 2001): 1195-1200. 12. Jonathan Wells, "Second Thoughts About Peppered Moths, This Clas- sical Story of Evolution by Natural Selection Needs Revising", The Scientist, voL 13, no. II (Mayo 24, 1999): p. 13. 13. Hulse, The Key to It AU: Book One, pp. 188-189. P ocas veces en la vida tenemos la oportunidad de recono- cer a las personas cuyas contribuciones hacen posibles nuestras logras. Aunque fue necesario cruzar las fronteras tra- 14. Aaron T. Wolf, "Indigenous Approaches to Water Conflict Resolu- dicionales de la ciencia, la religion y la historia para crear este tion and Implications for International Waters," International Nego- tiation, vol 5, no. 2 (Diciembre 2000): pp. 357-373. EI informe que libra, fue gracias a la dedicacion de expertos en estos campos se cita en este texto se reviso antes de su puhlicaci6n en la revista. espedftcos que ahora puedo compartir mi trabajo con certeza 15. Ibidem. y conftanza. Esta secci6n es mi oportunidad de expresar mi 16. Ibidem. agradecimientq a todos los que contribuyeran a llevar a feliz 17. Ibidem. termino EI codigo de Dios, jen ocasiones en formas que ellos ni siquiera supieron! Apendice A Tengo una deuda especial de gratitud con: 1. David Allen Hulse, The Key ofIt AI/, An Encyclopedic Guide to the La chispa de la divinidad que esca en el interior de toda Sacred Languages & Magickal Systems ofthe World. Book One: The Eas- vida y que se da a conocer a traves de nuestras creaciones. Gra- tern Mysteries, pp.188-189. cias por estar conmigo siempre. Ned Leavitt, mi agente literario. Ned, te envio mi aprecio m<is profundo por ayudarme a moldear este descubrimiento y convertirlo en un libra, y por guiarlo por el mundo editorial. Desde el primer d(a en que consideramos las implicaciones de un mensaje en el c6digo de la vida, tu guia ha sido invaluable, tu integridad impecable y tu confianza en mt ha sido constante. Stephanie Gunning, mi editora y ahora mi amiga, a traves de nuestras conversaciones para agregar detalles a la esencia de t'stt' I ihm, jsiemprc h ici'iH.' eX;lC(alllC!ltC has pregllntas adeclla- d.l\ y dt' 1.1 11 Llllt'LI prn i \;1 p.l Ll I kg;l r ;1 1;1'\ Illcjon'" Opl lllllt''\! 330 EI C6digo de Dios Reconocimientos 331 Muchas gracias par tu profesionalismo, par la dedicaci6n y to posib1e. Tu voJuntad de seguir un Hamado que llega desde destreza que imprimes en todo 10 que haces, y par tu paciencia regiones que rehasan 1a vision del mundo aceptada. nos abre el can mis palabras y mis horarios. Ante rodo, igracias por ayu- camino para llegar a ser mejores y a crear un mundo mejor. darme a tomar las complejidades de la ciencia y transformarlas A todas las personas de Hay House, ofrezco mi aprecio en la alegrfa de una sabidurfa que cia poder! sincero y mi mas profunda gratitud. A Reid Tracy, presidente Dr. Todd Ovakaytis y Mary Kennedy, estoy profundamente y gerente general, gracias por tu vision y tu fe inamovible en agradecido a ambos par su buena disposici6n a teabajar con- mi trabajo. Despues de cinco aftos de interesantes e inespera- migo durante ellargo pedodo en que no se divulg61a natura- dos cambios, jfinalmente estamos trabajando en un proyecto! leza de nuestro trabajo, jsin saber siquiera a d6nde nos llevada! A Jill Kramer, mi editora interna, muchfsimas gracias por A 10 largo de dos afios despues de nuestra primera reuni6n en guiarme, por tus opiniones honestas y por los aftos de expe- nuestro hord de Paris, sus conocimienros del campo de 1a bio- riencia que se reflejaron en cada una de nuestras conversacio- logia molecular, medicina y estadistica me han ayudado a pre- nes. En verdad eres una experta en tu oficio. Tus palabras de parar el camino para el siguienre nive! de exploraci6n. Ustedes alienro durante el trabajo de edicion significaron mucho mas encarnan una combinaci6n de mente beillante, corazon bon- de 10 que supones, iY conservo tu hoja de comemarios en mi dadoso y disponibiIidad para compartie, por 10 que me siento oficina como apoyo e inspiraci6n! bendecido y agradecido. Un agradecimiento muyespecial a Katie Williams, Jacqui David Allen Hulse, mi gran amigo, gracias par seguir tu Clark, Jeannie Llberati, Margarete Nielsen y John Thompson. pasion por desenrrafiar el Gran Misterio, por tu volunrad de No hubiera yo podido pedir un grupo de personas mas compartir tus descubrimienros con otros, y tu inruici6n para agradables, ni un equipo mas dedicado para apoyar este libro. responder al primer correo electronico que hizo posible nues- Su entusiasmo y profesionalismo son insuperables. Gracias tra amistad. Sin saber precisamenre a que estaban contribu- a su confianza en mi, me send bienvenido en la familia de Hay yendo tus conocimientos sobre idiomas antiguos, tu buena House. disposicion para trabajar conmigo ha sido un ejemplo del gra- A Melissa, ofrezco mi mas profunda gratitud por su pa- do de confianza por el que me sienro eternamente agradecido. ciencia ante las demandas que crea elHevar a cabo un proyecto jHa sido un honor colaborar contigo en la busqueda de mayor de esta magnitud. Gracias por tomar el tiempo para escuchar, sabicluria, y sienro que nuestro trabajo juntos todavia no esci apoyar y sugeeir, yen especial par tU punto de vista artistico. A completo! 10 largo de lao temporada en que me viste en mis peores mo- Hank Wesselman, tu oferta de revisar este libro me lleg6 mentos, yen mis mejores, tu amistad ha permanecido cons- precisamente en la forma correcta, y en el momento preciso. tante y tu fe en mi persistente. Por favor acepta mi sincero agradecimiento por compartir los Al hermosa cspfrilll de nuestro perrito lanudo, Brillo; gra- mas recientes descubrimientos en eI campo de la evoluci6n y cias pOl' Ia fdi(id~I\.l qm' tracs a nuesua vida, par recodarnos 10 dl' 1I11l'.'itro pasado, (Xlr;) haeC'r que l'.'ite lihro ftlt'Ll 10 Jlds eX;IC- qllC\lgllili(.1 Unl,H ,Illlli .1 IWI';I" , V pOI III UlIllP;liILIl'1l h\ hOLI,> 332 El C6digo de Dios Reconocimientos 333 de incontables mananas, mientras dormfas en la colchoneta de de unir el trabajo y la familia al enfrentarnos a las incertidum- yoga junto a mi escritorio mientras yo escribia. bres de nuestro mundo cambiante! Gracias a Charlene y a rodos nuestros amigos del Bent Street Para M. A. Bjarkman y Rae Baskin, fundadores de The Cafe; a Angela, a Tony y a todo el fantastko personal del Apple Conference Works y a Carol Simmons, Sharon Kerig, Darrin Tree Restaurant... a 10 largo de los ailos, su bondad ha estado Owens, Kathalin Walker y a todo el equipo tras bambalinas, presente para mf, en el momenta justo, en formas en que ni gracias par su visi6n y dedicaci6n, par compartir mi pasi6n y siquiera imaginan. Mi mas profundo aprecio y agradecimien- estar abiertos a las posibilidades. to por siempre atenderme bien, y par preparar platillos tan A Robin y Cody Johnson, fundadores de Prophets Confe- hermosos que me han mantenido fuerte y concentrado a 10 rences, les mando un mont6n de graritud por su destreza para largo de mis viajes y en el proceso de escribir. reunir rantas mentes diversas que trabajan para lograr un mun- A mi madre, Sylvia Braden, y a mi hermano, Eric, gracias do mejor, y par induirme en esa vision. Un agradecimiento par su amor incansable y por creer en mi. Mi gratitud par especial par recordarme que todos somos profetas. jA rodos, todo 10 que aportan a cada dfa de mi vida que va mas aHa de mi mas sincera aprecio y gran respeto por su voluntad de ex- cualquier palabra que pudiera yo escribir en esta pagina. De la plorar nuevas fOfmas de trabajar juntos en nuestro mundo cam- libertad que brota de ese apoyo, nos hemos vista can mayor biante! frecuencia, y nos hemos acercado mas como familia que en nin- Me honta l~ confianza de rodos los que han asistido a nues- gun otro momenta del pasado. Aunque mi familia de sangre tras presentaciones en vivo. Gracias a su respuesta, he aprendi- es pequeila, juntos hemos encontrado que nuestra familia ex- do a escuchar mejer, y he escuchado las palabras que me tendida de amor es mayor de 10 que alguna vez imaginamos. permiten compartir un mensaje de poder, de esperanza y de Estoy orgulloso de ser parte del equipo virtual que se ha posibilidades. Siempre estare agradecido con ustedes. convertido en una familia dedicada que me ha ayudado a com- partir mi trabajo por todo el mundo. A Lauri Willmot, mi gerente favorita (y unica), mando mi admiraci6n y agradeci- miento por siempre estar alii, iY en especial cuando mas se necesita! A medida que nuestra obra llega a las mentes y cora- wnes de un numero creciente de personas, siento mas aprecio por ustedes con cada ana que pasa. A Tom Park, de Park Productions, y a Jerry y Robin Miner de Source Books/Sacred Spaces Productions, mando mi agradecimiento por su amor, apoyo y buena disposici6n para "persistir" de acuerdo a los principios que nos reunieron origi- nal Illt'IHt'. i!untos, ht'lllos aprendido rOf!lUS llIlt'Vas y neat ivas SOBRE ELAUTOR G regg Braden, autor de best-sellers del New York Times ha sido orador invitado en conferencias internacionales yen transmisiones especiales en los medios, donde ha tratado el tema del pape! de fa espiritualidad en la tecnologIa. Ante- riormente fue jefe diseftador de sistemas de computo (Martin Marietta Aerospece), ge610go por computadora (Phillips Pe- troleum) y supervisor de operaciones t(~cnicas (Cisco Systems), yahora se Ie con;idera una autoridad en el campo de crear un puente entre la sabiduria de nuestro pasado y la ciencia, tecno- ; 10gfa y paz de nuestro futuro. Sus viajes a remotas aldeas de molltafias, monasterios y tem- plos del pasado, junto con sus antecedentes en el campo de la ciencia pura, 10 califican para aportar hoy a nuestras vidas el beneficio de antiguas tradiciones perdidas por largo tiempo. A partir de su innovadora obra, Awakening to Zero Point [Despertar en el Punto Cero}, hasta su obra pionera Walking Between Two Worlds [Caminar entre dos mundos} y la contro- versia de The !saiah Effect fEt eJecto Isaias}, Gregg Braden se ha aventurado mas alIa de los lfmites de la ciencia y la espirituali- dad, ofreciendo soluciones significativas a los reros de nuestro £Iempo. 336 El C6digo de Dias Para mayor informacion, ponerse en contacto con la ofici- na de Gregg en: Wisdom Traditions P.O. Box 5182 Santa Fe, NM 87502 TITULOS DE ESTA COLECCION 505-424-6892 ssawbraden@aol.com EI Ciidigo de Dios Gregg Braden EI Ciidigo Jesus John Randolph Price La Conspiraciiin del Grial Lynn Sholes & Joe Moore La Cosrnologia Oculta de la Biblia Gordon Strachan Los Ternplarios. Juan Pablo Morales Anguiano Misterios y Secretos de los Tern plarios Lionel & Patricia Fanthorpe